#ZooKeys
ZooKeys 1240: 1-38 (2025) DOI: 10.3897/zookeys.1240.151016
Research Article
A new microendemic gecko from the small forest fragments of south-eastern Madagascar (Squamata, Gekkonidae, Paragehyra)
Francesco Belluardo'*2“®, Costanza Piccoli23*©, Javier Lobon-Rovira?®, lvo Oliveira Alves2*5©®, Malalatiana Rasoazanany®, Franco Andreone”™®, Goncalo M. Rosa®?"°®, Angelica Crottini"'®
1 EnviXLab, Department of Biosciences and Territory, University of Molise, Contrada Fonte Lappone s.n.c., 86090 Pesche, Italy 2 CIBIO, Centro de Investigac¢ao em Biodiversidade e Recursos Genéticos, InBIO Laboratorio Associado, Universidade do Porto, Campus de Vairao, Rua Padre
Armando Quintas, 4485-661 Vairao, Portugal
Departamento de Biologia, Faculdade de Ciéncias, Universidade do Porto, Rua do Campo Alegre s/n, 4169-007 Porto, Portugal
BIOPOLIS Program in Genomics, Biodiversity and Land Planning, CIBIO, Campus de Vairao, Rua Padre Armando Quintas, 4485-661 Vairao, Portugal Departamento de Biologia Animal, Faculdade de Ciéncias, Universidade de Lisboa, Campo Grande, 1749-016 Lisboa, Portugal
Mention Zoologie et Biodiversité Animale, Domaine Sciences et Technologieiiscussions, Université d Antananarivo, B.P 906, 101 Antananarivo, Madagascar Museo Regionale di Scienze Naturali, Via G. Giolitti 36, 10123 Torino, Italy
[MIB Biodiversity Research Institute (CSIC, Universidad de Oviedo, Principality of Asturias), c/ Gonzalo Gutiérrez Quirds, 33600 Mieres, Spain
Institute of Zoology, Zoological Society of London, Outer Circle, Regent’s Park NW1, 4RY London, UK
mo DAN DTD Oo FS WwW
10 Centre for Ecology, Evolution and Environmental Changes (CE3C), Faculdade de Ciéncias, Universidade de Lisboa, Campo Grande, 1749-016 Lisboa, Portugal 11 Department of Biology, University of Florence, Via Madonna del Piano 6, I-50019 Sesto Fiorentino, Italy Corresponding author: Francesco Belluardo (francesco. belluardo@unimol.it)
OPEN Qaccess
Academic editor: Anthony Herrel Received: 21 February 2025 Accepted: 25 March 2025 Published: 2 June 2025
ZooBank: https://zoobank. org/07E50361-046B-4D1 7-8CF0- 6BA4CD04DD73
Citation: Belluardo F, Piccoli C, Lobon- Rovira J, Oliveira Alves |, Rasoazanany M, Andreone F, Rosa GM, Crottini A (2025) A new microendemic gecko from the small forest fragments
of south-eastern Madagascar (Squamata, Gekkonidae, Paragehyra). Zookeys 1240: 1-38. https://doi. org/10.3897/zookeys.1240.151016
Copyright: © Francesco Belluardo et al. This is an open access article distributed under terms of the Creative Commons Attribution
License (Attribution 4.0 International - CC BY 4.0).
Abstract
Historically, herpetological research in Madagascar has largely overlooked small forest fragments outside the country protected area network. Despite substantial declines in species diversity compared to large continuous forests, these fragments continue to sustain diverse herpetological communities and frequently harbour microendemic species. We describe a new gecko belonging to the genus Paragehyra, apparently microendemic to small and isolated forest fragments surrounding the Andringitra Massif in south-eastern Madagascar. Paragehyra tsaranoro sp. nov. is different from its congeneric species based on genetic distances in mitochondrial markers (16S and CO), phylogenetic position, and the lack of haplotype sharing at one nuclear locus (POMC). The new species is also distinguishable from its congeners based on a combination of 14 morphological characters. New genetic and morphological data are also provided for the sympatric P. felicitae and we propose a new assessment of its conservation status within the IUCN Red List. Paragehyra tsaranoro sp. nov. and P. felicitae are mostly found in forest fragments managed by local communities (community-managed reserves) outside legally protected areas. This study highlights the importance of community- based management for the conservation of local herpetofauna, particularly in regions heavily impacted by anthropogenic pressure and largely unsuitable for forest-dwelling species. The findings emphasise the importance of conducting research on small forest fragments, as they are essential for completing the inventory of Malagasy herpetofauna.
Key words: Community-based management, deforestation, integrative taxonomy, mitochondrial DNA, morphology, nuclear DNA, reptiles
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Introduction
Madagascar is recognised as a global hotspot of reptile diversity (Roll et al. 2017). Currently, the island hosts 439 nominal species of native terrestrial rep- tiles, with 98% of these being endemic (Antonelli et al. 2022; Glaw et al. 2022; Raselimanana and Vences 2022; Uetz et al. 2025) and approximately one-third being microendemic (i.e., with distributional ranges lower than 1,000 km?; sensu Brown et al. 2016). Since 1990 the rate of reptile species descriptions in Mada- gascar has surged, with ca 40% of native species formally described, although the likely significant level of undescribed diversity (Nagy et al. 2012; Moura and Jetz 2021; Antonelli et al. 2022; Glaw et al. 2022). Such accelerated rate results from the combination of increased fieldwork efforts for species inventories and the use of molecular techniques for species identification (associated with a constantly increasing reference database), which together have expedited the identification of candidate species (sensu Vieites et al. 2009) (Yoder et al. 2005; D’Cruze et al. 2009; Nagy et al. 2012; Glaw et al. 2022; Vences et al. 2022a). The application of a taxonomic approach integrating multiple lines of evidence for species delimitation facilitates rapid and reliable evaluations of the taxonomic status of candidate species, aiding in their formal description (Vieites et al. 2009; Padial et al. 2010; Carné and Vieites 2024; Miralles et al. 2024).
The process of biodiversity cataloguing and description is essential in a pe- riod of global biodiversity crisis, as many lineages that are unknown to science might have gone or will go extinct before being identified and formally protected (Giam et al. 2012; Primack 2014; Dijkstra 2016; Chapple et al. 2021). In the case of Madagascar, deforestation is among the main threats to biodiversity, with almost half of the forest cover that was estimated in 1953 to have been lost since then, and many of the remaining forests that suffer from severe fragmen- tation and degradation (see Lehtinen and Ramanamanjato 2006; Irwin et al. 2010; Jenkins et al. 2014; Nopper et al. 2018; Vieilledent et al. 2018; Crottini et al. 2022; Ralimanana et al. 2022). In Madagascar, herpetological research has historically focused on protected areas and more pristine forests (D’Cruze et al. 2009; Vences et al. 2022a). Despite small and heavily impacted forest frag- ments tend to support poorer herpetological communities compared to larger, continuous forests, recent inventories have nonetheless led to the identification of several new candidate species (e.g., Lehtinen and Ramanamanjato 2006; Irwin et al. 2010; Crottini et al. 2011a, 2014; Durkin et al. 2011; Belluardo et al. 2021a). Many of these candidate species have since been formally described (e.g., Gehring et al. 2010; Crottini et al. 2011b, 2012a, 2015; Protzel et al. 2018).
Geckos are the most species-rich squamate group in Madagascar (Anton- elli et al. 2022; Bauer et al. 2022; Uetz et al. 2025). They are divided into 11 genera belonging to the family Gekkonidae Oppel, 1811, although they rep- resent multiple clades with independent origins and colonisation histories (Crottini et al. 2012b; Gamble et al. 2015; Zheng and Wiens 2016; Antonelli et al. 2022; Bauer et al. 2022). The genus Paragehyra Angel, 1929 is endemic to Madagascar and currently comprises four nominal species. These animals are mainly nocturnal and rupicolous, being mostly found on large boulders, cliffs, and caves, often associated with water courses (Nussbaum and Raxworthy 1994; Glaw and Vences 2007; Crottini et al. 2015). Paragehyra austini Crotti- ni, Harris, Miralles, Glaw, Jenkins, Randrianantoandro, Bauer & Vences, 2015
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 1
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
and P. gabriellae Nussbaum & Raxworthy, 1994 are distributed in the extreme south-east of Madagascar. Paragehyra austini is known from a single locality of montane rainforest in the western slopes of the Andohahela Massif, whereas P. gabriellae is found in lowland rainforests between the eastern slopes of the Andohahela Massif to the west and the coastal mountain ranges of Vohimena and Anosyenne to the east and south (Nussbaum and Raxworthy 1994; Crot- tini et al. 2015). Paragehyra petiti Angel, 1929 is distributed in south-western Madagascar, close to the city of Toliara, one of the most arid regions of the island (Nussbaum and Raxworthy 1994). The few specimens known for this species were found in a calcareous area surrounded by arid thornbush vegeta- tion within an alluvial plain next to the coast (Nussbaum and Raxworthy 1994; Glaw and Schmidt 2003; Crottini et al. 2015). Paragehyra felicitae Crottini, Har- ris, Miralles, Glaw, Jenkins, Randrianantoandro, Bauer & Vences, 2015 is known from two fragments of semi-deciduous dry forest located in the western part of the region surrounding the Andringitra Massif, close to the town of Ambala- vao (south-eastern Madagascar) (Crottini et al. 2015; Belluardo et al. 2021a). Finally, another population of Paragehyra (P. sp. aff. petiti 1 sensu Crottini et al. 2015) is known from Tsingy de Bemaraha in western Madagascar (Glaw and Vences 2007; Bora et al. 2010; Crottini et al. 2015). Although morphological data suggest it might represent a new species to science, it was not possible to fully evaluate the taxonomic status of this population due to the lack of genetic data and available specimens (Crottini et al. 2015).
The genus Paragehyra has been poorly studied for a long time, with the ho- lotype of the type species P. petiti being the only known specimen until ca 30 years ago (Angel 1929; Nussbaum and Raxworthy 1994). When Nussbaum and Raxworthy (1994) described the second species P. gabriellae, they also re-diagnosed the genus by providing two derived morphological characters to discriminate Paragehyra from the remaining gekkonids. They also defined nine interspecific morphological diagnostic traits, which they used to re-described P. petiti. Approximately 20 years later, Crottini et al. (2015) expanded on this work by describing P. austini and P. felicitae using an integrative taxonomic approach combining morphological and molecular evidence. They also defined five additional diagnostic morphological characters to discriminate between congeneric species and produced molecular data from all nominal species. This data was analysed within a phylogenetic framework, providing the first species-level phylogenetic hypothesis for the genus (Crottini et al. 2015).
In this study, we formally describe the lineage of Paragehyra previously re- ported as P. sp. aff. felicitae “Tsaranoro” in Belluardo et al. (2021a), and only recently discovered during a herpetological inventory conducted in the region surrounding the Andringitra Massif (Fig. 1; Belluardo et al. 2021a). The new species was found in the western part of the region, ca 20 km south of the type locality of P. felicitae. While Andringitra National Park (Andringitra NP) protects most of the Massif, the western portion of the region is not included in the national network of protected areas and has been heavily impacted by defor- estation, with a few remaining and isolated small forest fragments embedded in a human-dominated landscape (Fig. 2; Crottini et al. 2015; Gould and Andri- anomena 2015; Gould and Gabriel 2015; Goodman et al. 2018). These remnant forest patches sustain diverse and, in some case, unique herpetological com- munities, often including microendemic species (Crottini et al. 2011b, 2012a,
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 3
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
2015; Belluardo et al. 2021a; Piccoli et al. 2023). Over the last years, some of these fragments became community-managed reserves, reflecting a shift in Madagascar’s environmental policy toward transferring natural resource man- agement from the central government to local communities. This approach aims to support sustainable livelihoods, enhance local biodiversity conserva- tion, and complement the conservation role of the national protected areas net- work (Raik 2007; Nopper et al. 2017).
We integrate morphological and molecular data to support the description of P sp. aff. felicitae “Tsaranoro”. Additionally, we provide new data on the dis- tribution and genetic and morphological variation of P. felicitae and propose a conservation status assessment for P. felicitae and the new species described here within the IUCN Red List.
Materials and methods
This study follows the design outlined by Crottini et al. (2015), expanding the morphological and molecular datasets of the genus Paragehyra with samples and specimens from new localities. We conducted new morphological and mo- lecular comparisons, adhering to the same procedures described in that study.
Sample codes abbreviations
Extraction number of analysed samples were coded as follows: Angelica Crot- tini’s extraction codes (AC; ACP), Aurélien Miralles’ extraction code (AM). Field collection numbers were coded as follows: Angelica Crottini Zoological Collec- tion (ACZC), Angelica Crottini Zoological Collection Voucher (ACZCV), Frank Glaw’s field series (FGMV; FGZC), Zoological Collection Miguel Vences (ZCMV), Aurélien Miralles’ field series (MIRZC), and Richard K. B. Jenkins’ field series (RBJ). Museum collection numbers were coded as follows: Kyoto University Museum, Kyoto, Japan (KUZ), Mention Zoologie et Biodiversité Animale, Uni- versité d’Antananarivo, Antananarivo, Madagascar (UADBA), and Zoologische Staatssammlung, Munich, Germany (ZSM).
Sampling and voucher collection
The specimens and tissue samples included in this study were sampled during a herpetological inventory conducted in the region of the Andringitra Massif in November and December 2018 (see Belluardo et al. 2021a). The area is domi- nated by the mountain chain (protected by Andringitra NP), which divides the re- gion into an eastern part characterised by the presence of humid climatic condi- tions and rainforest and a western part with drier conditions and the occurrence of semi-deciduous dry forest (Goodman 1996; Goodman et al. 2018). The study area is located on the western side of the region (Fig. 1), which hosts, especially outside Andringitra Massif and Andringitra NP, several small and isolated forest fragments composed of semi-deciduous and southern dry-adapted rupicolous vegetation located at the base of small granitic peaks at ca 900 m a.s.I. Three among the largest fragments are community-managed reserves: Tsaranoro (46 ha), Anja (36 ha), and Sakaviro (14 ha) (Fig. 2; Gould and Andrianomena 2015; Gould and Gabriel 2015; Gabriel et al. 2018; Belluardo et al. 2021a).
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 4
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
__, -Sakaviro,’/
Anja
el,
Wa 4
Tsaranoro
‘ = lantaranomby
@ P austini @ P gabriellae
@ P felicitae
@ P. tsaranoro sp. nov.
© P petiti ©) P cf. petiti [-] Andringitra National Park
Figure 1. Distribution of the genus Paragehyra in Madagascar, with a focus on the Andringitra Massif region, where P. tsaranoro sp. nov. and P. felicitae occur in sympatry. lantaranomby is within the borders of Andringitra National Park. Star symbols denote the type localities of the two species. Coordinates of sampling localities are provided in Suppl. material 1. Map created using the Free and Open Source QGIS (Map data ©2015 Google). Species names anticipate the taxonomic decisions proposed in this study.
We collected tissue samples from 15 individuals of P. felicitae at two locali- ties (Anja and Sakaviro) and 15 individuals of P. sp. aff. felicitae “Tsaranoro” at three localities (Tsaranoro, AMbatomainty, and lantaranomby) (Figs 1-3; Suppl. material 1). Animals were caught by hand during opportunistic searches. Each individual was photographed, and the collection locality was recorded with a GPS receiver (Suppl. material 1). We clipped tail tips from each animal (or a toe in case of voucher specimens; see below) and stored them in 96% ethanol for molecular analyses. Four individuals of P. felicitae and seven individuals of P sp. aff. felicitae “Tsaranoro” were euthanised with an intracoelomic injection of a saturated solution of MS222 and kept as vouchers (Suppl. material 1). Vouchers were fixed in 96% ethanol and kept in 70% ethanol for long-term stor- age and deposited in the institutional collections of ZSM and UADBA.
Morphological measurements
Morphological characters of the voucher specimens were inspected by FB and confirmed by AC, CP and IOA. FB took morphometric measurements with a dig- ital calliper to the nearest 0.1 mm (Table 1; Suppl. material 2). The scheme of the species description and the definition of morphological characters follow
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 5
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Figure 2. Sampling sites of P. tsaranoro sp. nov. (A-C) and P. felicitae (E, F) A Ambatomainty B western slopes of the Andringitra Massif with Tsaranoro forest in the distance indicated with an arrow C lantaranomby (Andringitra National Park) D western side of Andringitra Massif E Sakaviro F Anja. Photographs by JL-R. Species names anticipate the taxo- nomic decisions proposed in this study.
Nussbaum and Raxworthy (1994) and Crottini et al. (2015), and the correspond- ing abbreviations are the same used in Crottini et al. (2015): HT, holotype; PT, paratype; M, male; F, female; J, juvenile; SVL, snout-vent length; TAL, tail length; TBW, tail base width; BW, body width; HL, head length; HW, head width; HD, head depth; SnL, snout length (mouth opening); ID, internarial distance; IOD, interorbital distance; ETD, eye-tympanum distance; ED, eye diameter; EO, ear opening (horizontal axis); SAD, snout-axilla distance (measured from the tip of the snout to the axilla with the forelimb extended laterally); AGD, axilla-groin distance; FL, forelimb length (measured from the point where the limb attaches
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Sow 6
Figure 3. Photographs of Paragehyra tsaranoro sp. nov. A holotype ZSM 11/2023 (ACZCV765) from Tsaranoro B ACZC10947 from Tsaranoro (voucher not collected) C, E paratype ZSM 10/2023 (ACZCV600) from lantaranomby (western slopes of Andringitra National Park) D ACZC10946 from Tsaranoro (voucher not collected) F ACZC10951 from Tsaranoro (voucher not collected). See Suppl. material 1 for sampling information and associated sequences available for these individuals. Photographs by JL-R. Species names anticipate the taxonomic decisions proposed in this study.
to the axilla to the tip of the longest digit); HiL, hind limb length (measured from the point where the limb attaches to the groin to the tip of the longest digit); IN, internasal scales; SL, number of enlarged supralabial scales; I, infralabial scales; ME, mental scale; 1PM, dimension of first postmental scales; 2PM, number of second postmental scales (defined as the enlarged scales in contact with first postmentals frontally and with small chin scales posteriorly); C, chin scales (de- fined as the small scales extending frontally towards the complex of infralabial
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 7
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Table 1. Variation of morphological diagnostic characters of Paragehyra specimens. Specimens of Paragehyra tsara- noro sp. nov. and the new individuals of P. felicitae analysed in this study are highlighted in bold, while the remaining specimens are from Crottini et al. (2015). Information on character states provided in the table footer. Species names anticipate the taxonomic decisions proposed in this study.
Species pao es Status Sex| BT TDL TT | C | VET| SPP| ss SSC DO| VE SC ME) 1PM P. austini ZSM 0338/2005 | PT F - - - | 1(9/8) 1 2 s/7 | 43 | 656,6a6665a | s= | st | st] 2 |L50+ P. austini ZSM 0339/2005 | HT M - - - | 1(8/8) 1 2 s/ | 33 | 433,54 4456a | s= | st] st | 2 |L50+ P. austini ZSM 0340/2005 | PT M - - - | 1(8/9) 1 2 s7 | 43 | 4,56,546,7,54a | s= | st | st | 2 |L50+ P. gabriellae | ZSM 0085/2004 = NA | +* - * | 1 (9/8) 2 1 s8 | 9-7 11,11,10,11 b; s= | st | st | 2 | L50- 12,11,10,10 b P. gabriellae | ZSM 0114/2004 7 NA) +* - * | 1(9/8) | 2 1 s7 | 87 10,10,10,10 b; s= | st | st | 2 | L50- 10,9,11,10 b P. gabriellae | ZSM 0173/2004 5 NA | +* - * | 1 (9/8) 3 1 s8 | 9-9 10,9,9,11 b; s= | st | st | 2 | L50- 11,10,10,11 b P. gabriellae | ZSM 0181/2004 ¥ NA) +* - * |1(10/9)) 2 1 s8 | 9-8 10,10,10,9 b; s= | st | st | 2 | L50 10,10,9,11 b P. gabriellae | ZSM 0182/2004 _ NA | +* - * 1(9/8) 2 1 s8 | 9-10 10,12,11,12 b; s= | st | st | 2 | L50 11,12,12,12 b P. gabriellae | ZSM 0336/2005 _ NA | +* - * | 1(9/9) | Le3;} 1 s9 | 9-9 9,10,11,10 b; s= | st | st | 2 | L50 R1 10,11,10,10 b P. gabriellae | ZSM 0337/2005 = NA | +* - * — 1(9/9) | Le3;| 1 s7 | 10-9 10,11,10,11 b; s= | st | st | 2 | L50 R2 12,12,11,11 b P. gabriellae | ZSM 0335/2005 i J +* - | NA 1(10/9)| 3 1 s9 | 9-9 10,10,10,10 b; s= | st |NA| 2 | L50- 12,11,11,11 b P. felicitae ZSM 1613/2010 PT F +/12 + + 1 (9/7) 3 |3(6)| s9 | 32 55,5,5¢:5565c | s=|s | st | 2 |L50+ P. felicitae ZSM 1612/2010 | PT M |} +/12 | + + | 1(8/7) 1 |3(6)| 16 | 33 | 4555¢6555c | s= | s | st} 2 |L50+ P. felicitae ZSM 1611/2010 | HT M | +/12 | + + | 1(8/9) | 3 |3()] 16 | 33 | 5555c¢6655c | s= | s- | st | 2 |L50+ P. felicitae ZSM 1610/2010 | PT M | +/12 | + + | 1(8/9) 1° 3:(6) 7) 16. 62-329 55556-55550 |0Ss= less | stal"2 Mb 50+ P. felicitae ZSM 14/2023 z F | +/12 |) + + | 1(8/7) | 1 |3(7)/I7/8| 3-3 5,5,5,6¢,4,5,5,4c s- s- | st) 1 | L50+ (ACZCV747) P. felicitae ZSM 13/2023 - J | +/12 | + + | 1(8/7) | 1 |3(3)/ 17/6) 3-2 544,4a;5,45,5c¢ s- s- | st) 2 | L50+ (ACZCV522)
P tsaranoro ZSM 10/2023 PT F +/12 | +* | NA 1(7/6) 1 | 3(6) 15/16 3-2 5,5,5,4a;4,5,5,6a | s- | s- /NA)| 2 | L50+ Sp. nov. (ACZCV600)
P tsaranoro ZSM 11/2023 HT M | #/12 | +* | + | 1(7/8) Le1;) 3(3) I5/l6) 3-3 | 5,5,5,5a;5,6,5,5a | s- | s- | st > 2 | L50+ Sp. nov. (ACZCV765) R4
P tsaranoro ZSM 12/2023 = J | 4/12 | +* | + | 1(8/8) 1 §3(4) 16 2-3 5,5,5,1a;5,4,65a | s- | s- | st) 1* | L50+
Sp. nov. (ACZCV809)
P. petiti ZSM 593/2000 7 M | +/10 | +* | + | 2(4/4) A O35!) 54) 33-3 5,5,4,4 c; 4,6,5,5 c s | s | & 1 | L50+
P. petiti ZSM 594/2000 | _ | M/ 4/10) +* | + | 2(5/5) | 1 |3(6)) IS | 22) 4444¢4444c¢ s |) s > s > 1 |L50+
P. petiti ZSM 592/2000 5 F | +/10 | +* | + | 2(6/5) |Le4;|}3(6)| I5 | 23 | 4.454¢;4444c | s- | s | s | 1 |L50+ R1
P. cf. petiti UADBA 28056 = M | +/10 + + | 1(6/5) 49 )'3:(6)) #17 NA NA s- | Ss | st | 1* | L50+
P. cf. petiti UADBA 28038 _ | M|4/10e} + | + | 1(6/5) | 1 13(6)| I7 | NA NA s | s | st | 1* | L50+
Abbreviations not reported in the text: Le, left; R, right. Description of the alternative character states: BT, body tubercles and number of longitudinal rows of enlarged tubercles on body (+, present; -, absent; *, small tubercles not arranged in distinct rows; £, 9 complete rows and 1 truncated row; #, number of rows); TDL, tubercles on dorsal surface of limbs (+, present; -, absent; *, present on hind limbs and only on distal portions on forelimbs); TT, tail tubercles (+, present and organised in transverse rows; -, absent; *, present but not organised in transverse rows); I, infralabial scales (1, decrease in size gradually in posterior direction; 2, first scales markedly larger than remainders; #, number of scales right/left); C, chin scales (1, lateral chin scales extend forward along each side, excluded from contact with first line of infralabials and first postmentals, in contact with second line of infralabials; 2, lateral chin scales extend forward along each side, in contact with first and second infralabials and with first postmentals; 3, lateral chin scales extend forward along each side, excluded from contact with first infralabials, in contact with first postmentals and second infralabials; 4, lateral chin scales extend forward along each side, excluded from contact with first and second infralabials and first postmentals, in contact with third infralabials); VET, ventral scales on distal (tibial) segment of hind limbs (1, normal size compared with scales on the proximal segments of hind limbs; 2, slightly larger; 3, enlarged into plates especially distantly; #, number of plates); SPP, scales on preaxial-ventral portion of pes between end of tibia and base of digit | (s, small; |, large; #, number of scales right/left); SS, subdigital scales between enlarged basal scales and distal pad on digit | of manus and pes (left side) (#, number of scales manus-pes); SSC, subdigital scales on claw-bearing segment of digits II-V of manus and pes (left side) (a, distalmost scale markedly larger; b, numerous small scales increasing gradually in size distantly; c, large scales almost equal in size; #, number of scales); DO, dorsal scales on body surface (s, smooth; k, keeled; =, equal size than ventrals; -, smaller than ventrals); VE, ventral scales on body surface (s, smooth; k, keeled; +, pigmented; -, unpigmented or poorly pigmented); SC, subcaudal scales (s, smooth; k, keeled; +, pigmented; -, unpigmented); ME, mental scale (1, bell- shaped; 2, triangle-shaped; *, modified); 1PM, dimension of first postmental scales (L, large; 50+, in contact for more than the 50% of their length; 50-, in contact for less than the 50% of their length; 50, in contact for the 50% of their length).
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 8
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
and postmental scales); DO, dorsal scales on body surface; BT, body tubercles and number of longitudinal rows of enlarged tubercles on body; TDL, tubercles on dorsal surface of limbs; TT, tail tubercles; VE, ventral scales on body sur- face; VET, ventral scales on distal (tibial) segment of hind limbs; SC, subcaudal scales; SCE, subcaudal scales enlarged transversely; PCP, number of precloacal pores; SPP, scales on preaxial-ventral portion of pes between end of tibia and base of digit |; SS, subdigital scales between enlarged basal scales and distal pad on digit | of manus and pes; SLMP, number of transversely enlarged sub- digital lamellae on claw-bearing segment digits II-V of manus and pes; SSC, subdigital scales on claw-bearing segment of digits II-V of manus and pes.
Molecular procedures
The newly collected voucher specimens included in this study have been mo- lecularly identified at the species level in Belluardo et al. (2021a) based on the inter-specific threshold of genetic distance at the cytochrome oxidase | gene (COI) suggested by Nagy et al. (2012) for geckos (accession numbers MZ285511-MZ285520; Suppl. material 1). In addition, sequences of the 16S gene fragment were used to complement species identification (accession numbers MZ285405-MZ285408; Suppl. material 1; Crottini et al. 2015; Bellu- ardo et al. 2021a).
We expanded the available molecular data by generating new sequences from these specimens and from tissue samples collected from individuals not retained as vouchers (Suppl. material 1). Specifically, we extracted total ge- nomic DNA following a saline solution extraction protocol (Bruford et al. 1992). We amplified one mitochondrial and two nuclear markers: a fragment of the 3’ terminus of the 16S rRNA gene (16S), a fragment of the brain-derived neuro- trophic factor gene (BDNF) and a fragment of the pro-opiomelanocortin gene (POMC) (Table 2). Amplifications were performed with a standard PCR protocol in a final reaction volume of 25 ul using 12.5 ul of Milli-Q water, 5 ul of 5X Green GoTag Flexi Buffer (Promega, Madison, US), 4 ul of MgCl2 (25 mM) (Prome- ga), 1 ul of each primer (10 pM) (Thermo Fisher Scientific, Waltham, US), 0.4 ul of dNTPs (10 mM) (Invitrogen, Waltham, US), 0.1 pl of 5 U/l GoTaq Flexi DNA Polymerase (Promega), and 1 ul of extracted genomic DNA (see Table 2 for information on thermal profiles and primers). Successfully amplified sam- ples were sequenced with an ABI 3730XL automated sequencer at Macrogen Inc. (Spain). Chromatograms were checked and edited, when necessary, using BIOEDIT 7.2.6 (Hall 1999). Newly generated sequences were deposited in Gen- Bank (PV383205-—PV383230; PV389996-PV390006; Suppl. material 1).
Table 2. Fragments amplified in this study with information on primer sequences and amplification conditions.
Gene 16S 16S BDNF BDNF POMC POMC
Primer name F: 16SL R: 16SH F: BDNF DRV F1 R: BDNF DRV R1 F: POMC DRV F1 R: POMC DRV R1
Sequence (5’-3’) Reference PCR conditions CGCCTGTTTATCAAAAACAT Palumbiet al. 1991 | 94 °C (90s), [94 °C (45s), 55 °C (45s), 72 °C CCGGTCTGAACTCAGATCACG Palumbi et al. 1991 (90s)I x 38, 72 °C (600s) ACCATCCTTTTCCTKACTATGG Vieites et al. 2007 | 94 °C (120s), [94 °C (20s), 52 °C (45s), 72 °C CTATCTTCCCCTTTTAATGGTC Vieites et al. 2007 (120)] x 39, 72 °C (600s)
ATATGTCATGASCCAYTTYCGCTGGAA Vieites et al. 2007 | 95°C (180s), [95 °C (60s), 44 °C (60s), 72 °C GGCRTTYTTGAAWAGAGTCATTAGWGG __séVieites et al. 2007 (90s)] x 40, 72 °C (600s)
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 9
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Molecular analyses
Crottini et al. (2015) compiled a molecular dataset of the markers 16S, BDNF, POMC, and recombination activating gene 1 (Rag1) with several individuals be- longing to all nominal species of the genus Paragehyra. We populated these datasets with the new sequences for the same markers (with the exception of Rag1, which was not analysed here; Suppl. material 1). We aligned sequences of each marker with the CLUSTAL W algorithm implemented in BIOEDIT 7.2.6 (Thompson et al. 1994; Hall 1999). Uncorrected pairwise genetic distances (un- corrected p-distances) within (between conspecific individuals) and between (averaged over conspecific individuals) species were computed on the 16S alignment with MEGA X 10.0.5 (Kumar et al. 2018). Following the same pro- cedure described for 16S, we computed uncorrected p-distances within and between species on an alignment including all COl sequences available in Gen- Bank for the genus Paragehyra (Suppl. material 1).
We inferred haplotype networks of the nuclear makers BDNF and POMC. We first trimmed all sequences to the same length (all sequences have been deposit- ed to GenBank in their original length). The BDNF sequence of ACP5938 (P sp. aff. felicitae “Tsaranoro”) has been deposited (PV390004), although it was excluded from the haplotype network analyses because it was much shorter than the others. We phased the alignments of the BDNF and POMC markers with the PHASE algo- rithm (Stephens et al. 2001; Stephens and Donnelly 2003) implemented in DNASP 6.12.03 (Rozas et al. 2017), setting 1,000 iterations, 10% burn-in and replicating the analyses three x, each analysis with a different starting seed value. We then inferred maximum likelihood (ML) trees from the phased alignments in MEGA X 10.0.5 (Kumar et al. 2018) setting Jukes-Cantor as substitution model. Haplotype networks were then computed for each marker on the phased alignments and the inferred ML trees with HAPLOTYPE VIEWER (written by G. B. Ewing; http://www. cibiv.at/~greg/haploviewer.shtml) to build a network from the tree topology fol- lowing the methodological approach described in Salzburger et al. (2011).
We performed a phylogenetic analysis on the 16S alignment using PIPELOG- ENY on R 4.0.2 (Mufoz-Pajares et al. 2020; R Core Team 2022). This pipeline facilitates the automated preparation of the input files for phylogenetic tools, which were subsequently executed in their respective standalone software applications. We used JMODELTEST 2.1.10 (Darriba et al. 2012) on the CIP- RES Science Gateway portal (Miller et al. 2010) to find the best model of se- quence evolution. We inferred the phylogeny with MrBayes 3.2.7 (Ronquist et al. 2012), available on the CIPRES portal, setting two parallel runs of 20-mil- lion generations, each consisting of four Markov Chain Monte Carlo chains. We set a sampling frequency of the chain at the 1,000" generation and a 40% burn-in. We evaluated the posterior distributions of each prior and the con- vergence of the two runs with TRACER 1.7.1 based on a minimum threshold of 200 Effective Sampling Size (Rambaut et al. 2018). The 50%-majority rule consensus tree was visualised with FIGTREE 1.4.4 (Rambaut 2009). We used the species Eublepharis macularius (Blyth, 1854), Geckolepis typica Grandi- dier, 1867, Blaesodactylus antongilensis (BOhme & Meier, 1980), Phelsuma lineata Gray, 1842, and Paroedura stumpffi (Boettger, 1879) as outgroups in our phylogenetic analysis. Eublepharis macularius was set as the primary outgroup in MrBayes analysis (Suppl. material 1).
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 10
Francesco Belluardo et al.: Anew gecko species of the genus Paragehyra
Results Justification for species delimitation
Following the integration by congruence approach (Padial et al. 2010) in defining species as independent evolutionary lineages based on at least two independent lines of evidence supporting their distinctness, our results support the hypothe- sis that the candidate species P sp. aff. felicitae “Tsaranoro” is distinct from all the other species of the genus Paragehyra and thus represents a new species to science. In anticipation of our taxonomic treatment, from now on we will use the newly proposed name for the new taxon even before the taxonomic section.
As a first line of evidence, P tsaranoro sp. nov. resulted as a monophylet- ic mitochondrial lineage (with full statistical support; Fig. 4B). This lineage showed a range of uncorrected p-distances at the 16S and COI gene fragments which were higher than the lowest value observed between two of the currently accepted species of the genus Paragehyra (i.e., the distance between P. felici- tae and P. petiti; Table 3). In addition, P tsaranoro sp. nov. shows uncorrected p-distances at the COI gene from all the other species for which we had com- parative material higher than the standard inter-specific threshold in Malagasy geckos at this marker (i.e., 13.3%) (Table 3; Nagy et al. 2012).
Paragehyra tsaranoro sp. nov. did not share POMC haplotypes with its congener- ic species (Fig. 4A). Considering the differences in the inheritance of mitochondrial and nuclear markers and the absence of recombination between them, the concor- dance between independent markers in supporting the distinctness of this lineage represents another line of evidence (Avise and Ball 1990; Rakotoarison et al. 2017).
Finally, the inspection of the inter-specific morphological characters of the genus Paragehyra (Nussbaum and Raxworthy 1994; Crottini et al. 2015) enabled to discriminate P. tsaranoro sp. nov. from all congeneric species, therefore, confirming its distinctness also at the morphological level (Table 4; Figs 3, 5, 6). In the following paragraphs, we provide a detailed description of the diagnosis of the new species relative to the remaining species of the genus Paragehyra based on molecular and morphological data.
Molecular differentiation
Phylogenetic analyses were performed on a 16S alignment of 530 bp length and included 66 sequences, 12 of which were newly generated from samples of P. tsaranoro sp. nov. and 14 were from newly collected samples of P.. felici- tae (Suppl. material 1). JMODELTEST analysis suggested “GTR+G” as the best model of sequence evolution under all information criteria (Akaike Information Criterion, corrected Akaike Information Criterion, and Bayesian Information Cri- terion). All species of the genus Paragehyra were recovered as monophyletic with the highest statistical support (Posterior Probability (PP) = 1.00), includ- ing the new species P tsaranoro sp. nov. (Fig. 4B). Paragehyra felicitae and P. petiti formed a strongly supported clade (PP = 1.00), and P. tsaranoro sp. nov. was recovered as sister to this (PP = 1.00). Paragehyra austini and P. gabriellae formed another strongly supported clade (PP = 1.00), whose relationship with the clade composed of P. felicitae, P. petiti, and P. tsaranoro sp. nov. was not supported (PP = 0.74), which means that the monophyly of the genus Parage- hyra did not receive strong statistical support with this dataset (Fig. 4B).
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 11
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
A
P. austini
BDNF P. gabriellae
P. felicitae
P. tsaranoro sp. nov.
P. petiti
5 10 20 40 KP025811 AM295 mir133 P. felicitae Anja Reserve KP025839 AM298 ZCMV12793 P. felicitae Anja Reserve Ambilo KP025815 AC1286 ACZC1960 P-. felicitae Anja Reserve ACP4719 ACZCV522 P. felicitae Anja Reserve Amboderano KP025812 AC1311 ZCMV13057 P. felicitae Anja Reserve KP025837 AM296 mir134 P. felicitae Anja Reserve ACP5922 ACZC10434 P. felicitae Anja Reserve Amboderano ACP5925 ACZC10444 P. felicitae Anja Reserve Amboderano KP025813 AC1307 ZSM 1613/2010 P., felicitae Anja Reserve ACP4312 ACZC1926 P. felicitae Anja Reserve KP025838 AM297 mir135 P. felicitae Anja Reserve ACP4720 ACZCV523 P. felicitae Anja Reserve Amboderano KP025836 AM294 mir132 P. felicitae Anja Reserve KP025840 AM299 ZSM 1610/2010 P. felicitae Anja Reserve Ambilo Sie ACP5923 ACZC10438 P. felicitae Anja Reserve Amboderano a . f el | Cl tae ACP5924 ACZC10440 P. felicitae Anja Reserve Amboderano KP025814 AC 1296 ACZC2012 P. felicitae Anja Reserve KP025841 AM293 ZCMV12792 P. felicitae Anja Reserve 1 ACP5926 ACZC10485 P. felicitae Anja Reserve Apatsakambe 0.97 — KP025816 AC1312 ZSM 1612/2010 P. felicitae Anja Reserve KP025817 AC1313 ZSM 1611/2010 P. felicitae Anja Reserve 1 MZ285405 ACP4961 ACZCV747 P. felicitae Sakaviro Voi Sakaviro Miray ACP5931 ACZC10917 P. felicitae Sakaviro Voi Sakaviro Miray 1 ACP5928 ACZC 10894 P. felicitae Sakaviro Voi Sakaviro Miray ACGP5930 ACZC10915 P. felicitae Sakaviro Voi Sakaviro Miray ACP4962 ACZCV748 P. felicitae Sakaviro Voi Sakaviro Miray ACP5927 ACZC10891 P. felicitae Sakaviro Voi Sakaviro Miray ACP5929 ACZC10897 P. felicitae Sakaviro Voi Sakaviro Miray 1 KP025818 AC1326 ZSM 593/2000 P. petiti Toliara ore KP025819 AC1350 ZSM 592/2000 P. petiti Toliara P. petiti 0.93- KP025820 AC1349 ZSM 594/2000 P. petiti Toliara ACP4984 ACZCV771 P. tsaranoro Tsaranoro Foret Sacre ACP5935 ACZC10947 P. tsaranoro Tsaranoro Foret Sacre 0.84 ACP5933 ACZC10944 P, tsaranoro Tsaranoro Foret Sacre MZ285407 ACP4979 ACZCV765 P. tsaranoro Tsaranoro Foret Sacre ACP5932 ACZC10933 P. tsaranoro Tsaranoro Foret Sacre ACP5025 ACZCV809 P. tsaranoro Ambatomainty Tsiomba ACP5026 ACZCV810 P. tsaranoro Ambatomainty Tsiomba c ; 0.86'— acps939 Aczc11022 P. tsaranoro Ambatomainty Tsiomba P. tsaranoro s p. nov. ACP5934 ACZC10946 P. tsaranoro Tsaranoro Foret Sacre ACP5937 ACZC10952 P. tsaranoro Tsaranoro Foret Sacre 0.98] ACP5936 ACZC10951 P. tsaranoro Tsaranoro Foret Sacre MZ285408 ACP4995 ACZCV779 P. tsaranoro Tsaranoro Foret Sacre 1 ACP5938 ACZC10973 P. tsaranoro Tsaranoro Foret Sacre MZ285406 ACP4799 ACZCV600 P. tsaranoro Andringitra western slopes lantaranombe ACP4994 ACZCV770 P. tsaranoro Tsaranoro Foret Sacre KP025822 AC1314 ZSM 0338/2005 P. austini Grotte Ampasy KP025825 AC1318 FG2C2368 P. austini Grotte Ampasy “Je KP025823 AC1316 ZSM 0339/2005 P. austini Grotte Ampasy P. au sti ni KP025824 AC1317 ZSM 0340/2005 P. austini Grotte Ampasy KP025821 AC1315 FGZC2365 P. austini Grotte Ampasy 1 KP025826 AC1319 ZSM 0085/2004 P. gabriellae Andohahela KP025828 AC1321 FGZC203 P. gabriellae Andohahela 1 KP025827 AC1320 ZSM 0114/2004 P. gabriellae Andohahela | KP025829 AC1322 ZSM 0173/2004 P. gabriellae Manantantely KP025833 AC1323 FGZC331 P. gabriellae Manantantely . KP025834 4C1325 ZSM 0182/2004 P. gabriellae Manantantely PB; gabriella e 0.82 KP025831 AC1347 ZSM 0336/2005 P. gabriellae Manantantely KP025832 AC1348 ZSM 0337/2005 P. gabriellae Manantantely
KP025835 AC1324 ZSM 0181/2004 P. gabrieiiae Manantantely KP025830 AC1346 ZSM 0335/2005 P. gabriellae Manantantely
1 Geckolepis typica 1 Blaesodactylus antongifensis Phelsuma lineata
Eublepharis macularius
0.02
Figure 4. Haplotype networks of nuclear markers and phylogenetic hypothesis for the mitochondrial 16S gene fragment A haplotype network reconstructions of BDNF and POMC markers (alignments of 533 bp with 41 individuals and 452 bp with 35 individuals, respectively) of the genus Paragehyra. Circles represent haplotypes and report the number of phased sequences assigned to each of them. Dots between circles represent unsampled or extinct haplotypes, whereas segments between dots are the number of reconstructed mutational steps between haplotypes B 16S phylogenetic tree (50%-majority rule consensus tree) of the genus Paragehyra inferred with MrBayes. Posterior Probability values are shown before the respective nodes, and values below 0.80 are not reported. Newly generated sequences are highlighted in bold. Datasets are described in Suppl. material 1.
The 16S uncorrected p-distances showed high inter-specific genetic distances within the genus, and P. tsaranoro sp. nov. resulted as clearly differentiated from any other species (Table 3). Paragehyra tsaranoro sp. nov. showed the lowest 16S distance with P. felicitae (6.49%). The largest 16S uncorrected p-distances for P. tsaranoro sp. nov. was observed between this lineage and P. gabriellae (12.93%). Similar to the other congeneric species, P. tsaranoro sp. nov. showed low within-species genetic distances (0.36%). This value was close to the levels observed in P. gabriellae (0.34%) and slightly lower than the one observed in P.
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 12
Francesco Belluardo et al.: Anew gecko species of the genus Paragehyra
Table 3. Uncorrected p-distances (16S and COI genes) expressed in percentage within (in bold along the diagonal) and between (below the diagonal) species of the genus Paragehyra. The number of individuals used to compute distances are shown in the first column after species names. Distances were computed with MEGA X 10.0.5 (Kumar et al. 2018). Within species uncorrected p-distances of the COI gene could not be computed for P. petiti and P. austini as one individ- ual was available for each of them.
P. felicitae P, tsaranoro sp. nov. P. petiti P. austini P. gabriellae 16S P. felicitae (28) 0.48 P. tsaranoro sp. nov. (15) 6.49 0.36 P. petiti (3) 5.10 7.46 0.13 P. austini (5) 13.95 12.67 13.70 0.00 P. gabriellae (10) 13.53 12.93 14.40 9.70 0.34 Col P. felicitae (5) 2.55 | rs P. tsaranoro sp. nov. (5) 15.67 1.28 - P. petiti (1) 11.03 17.10 NA = P. austini (1) 20.95 20.78 18.98 NA -
felicitae (0.48%) (Table 3). Although based on a much lower number of analysed individuals and lacking sequences of P. gabriellae, the uncorrected p-distances computed at the COI gene fragment (based on an alignment of 664 bp length and 12 individuals) are concordant with the pattern observed at the 16S marker (Ta- ble 3). Paragehyra tsaranoro sp. nov. showed the lowest inter-specific distance with P. felicitae (15.67%) and the highest distance with P. austini (20.78%). Simi- lar to the pattern observed at the 16S marker, P. tsaranoro sp. nov. had relatively low levels of within-species uncorrected p-distances at the COI fragment (1.28%), almost half of the values observed for P. felicitae (Table 3).
We generated eleven new sequences of the nuclear markers BDNF and POMC from P. tsaranoro sp. nov. and P. felicitae (Suppl. material 1). The recon- structed networks (Fig. 4A) showed consistency with phylogenetic analyses in suggesting a closer relationship between P. felicitae, P. petiti, and P. tsaranoro sp. nov. relative to P. austini and P. gabriellae. We recovered a single haplo- type for P. tsaranoro sp. nov. in both nuclear markers. The BDNF haplotype was shared with P. felicitae and P. petiti and two mutational steps distant from P. austini and P. gabriellae. At the POMC, three mutations separated P. tsara- noro sp. nov. haplotype from one of the two haplotypes recovered in P. felicitae.
Paragehyra tsaranoro sp. nov. https://zoobank.org/A79CE326-4EC 1-431 D-A3D3-BE728E55540E Figs 3, 5, 6, Tables 1, 4, Suppl. material 2
Note. The species has been reported as Paragehyra sp. aff. felicitae “Tsara- noro” CCS in Belluardo et al. (2021a).
Type material. Holotype. MADAGASCAR * 1 adult 3; south-eastern Madagascar, Haute Matsiatra Region, Fianarantsoa province, ca 32 km south of the town of Ambalavao, Tsaranoro, Forét Sacrée; 22°04'57.65'S, 46°46'33.56"E; 927 maz.s.l.; 6 Dec. 2018; F. Belluardo, J. Lob6n-Rovira, M. Rasoazanany leg.; boulder in semi-de- ciduous forest close to the forest edge; GenBank: MZ285407; ZSM 11/2023: ACZCV765. Figs 3A, 5. Paratypes. MADAGASCAR * 1 adult 9; south-eastern Mada- gascar, Haute Matsiatra Region, Fianarantsoa province, western slopes of Andringi-
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 13
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Figure 5. Dorsal and ventral views of Paragehyra tsaranoro sp. nov. holotype ZSM 11/2023 (ACZCV765). A few diagnos- tic characters are visible. In the dorsal view: 12 distinct longitudinal rows of enlarged tubercles on body surface (BT), enlarged tubercles on the entire surface of hind limbs and on distal dorsal portions of forelimbs (character TDL), and enlarged tubercles organised in transversal rows that encircle dorsolateral tail surface (character TT). In the ventral view: smooth unpigmented or poorly pigmented scales on body surface (character VE), and smooth and pigmented subcaudal scales (character SC). Photographs by CP. Scale bar: 2 cm.
tra National Park, lantaranomby; 22°07'42.60"S, 46°50'52.90"E; 1,610 ma.s.l.; 19 Nov. 2018; F. Belluardo, J. Lob6n-Rovira, G. M. Rosa leg.; boulder in open environ- ment with scattered palm trees; GenBank: MZ285406, PV389999; ZSM 10/2023: ACZCV600. Fig. 3. MADAGASCAR * 1 juv.; south-eastern Madagascar, Haute Mat- siatra Region, Fianarantsoa province, Ambatomainty, Tsiomba; 22°00'10.37'S, 46°47'16.08"E; 960 m a.s.l.; 8 Dec. 2018; F. Belluardo, J. Lob6n-Rovira, M. Ra- soazanany leg.; large boulders in open environment surrounded by scattered trees; GenBank: MZ285516, PV383222; ZSM 12/2023: ACZCV809. MADAGASCAR - 1 adult 4; same data as preceding; 22°00'09.40"S, 46°47'16.22"E; 947 ma.s.l.; same data as preceding; same data as preceding; same data as preceding; Gen- Bank: MZ285517, PV383221, PV389997; UADBA uncatalogued: ACZCV810. MAD- AGASCAR * 1 unsexed adult; south-eastern Madagascar, Haute Matsiatra Region, Fianarantsoa province, Tsaranoro Forét Sacrée; 22°04'51.71"S, 46°46'36.88'"E; 909 m a.s.l.; 6 Dec. 2018; F. Belluardo, J. Lobdn-Rovira, M. Rasoazanany leg.; large boulders within semi-deciduous forest; GenBank: MZ285518, PV383219, PV389998; UADBA uncatalogued: ACZCV771. MADAGASCAR * 1 unsexed adult; same data as preceding; 22°05'05.03"S, 46°46'30.54"E; 933 m a.s.l.; same data as preceding; same data as preceding; same data as preceding; GenBank: MZ285519, PV383220, PV390005; UADBA uncatalogued: ACZCV770. MADAGAS- CAR * 1 unsexed adult; same data as preceding; 22°05'07.58"S, 46°46'30.32"E;
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 14
Francesco Belluardo et al.: Anew gecko species of the genus Paragehyra
983 m a.s.l.; same data as preceding; same data as preceding; same data as preceding; GenBank: MZ285520, MZ285408; UADBA uncatalogued: ACZCV779.
Type locality. Tsaranoro Forét Sacrée (south-eastern Madagascar, Haute Matsiatra Region, Fianarantsoa province, ca 32 km south of the town of Am- balavao), 22°04'57.65"S, 46°46'33.56"E, 927 m a.s.l. A semi-deciduous forest fragment of ca 46 ha within Tsaranoro Valley Forest reserve (Figs 1, 2).
Diagnosis. The species is assigned to the genus Paragehyra based on ge- netic distances at the COI and 16S markers, the presence of two diagnostic morphological derived characters of the genus relative to the other gekkonids: the asymmetrical relationship of the claw and toe-pad on digit | and the unis- cansorial distal pad on digit | separated from enlarged basal scales by a series of smaller scales (Nussbaum and Raxworthy 1994; Crottini et al. 2015). The inter-specific diagnosis is detailed in the following lines (Fig. 6; Tables 1, 4).
Paragehyra tsaranoro sp. nov. has 12 distinct longitudinal rows of enlarged tu- bercles on the body dorsolateral surface (character BT), enlarged tubercles on the entire dorsal surface of hind limbs and on distal dorsal portions of forelimbs (char- acter TDL), enlarged tubercles organised in transversal rows that encircle tail dor- solateral surface (character TT), 6-8 enlarged infralabial scales gradually decreas- ing in size in posterior direction (character 1), lateral chin scales extending forward along each side, excluded from contact with first line of infralabials and first post- mentals, in contact with second line of infralabials (character C), 3-6 ventral scales on the distal (tibial) segments of hind limbs enlarged into plates especially in the most distal part (character VET), five or six large scales on preaxial ventral portion of pes between end of tibia and base of digit | (character SPP), two or three small subdigital scales between enlarged basal scales and terminal distal pad on digit | of manus and pes (character SS), 4-6 subdigital scales on claw-bearing segment of digits II-V of manus and pes with the distalmost scale markedly larger than the others (character SSC), smooth dorsal scales on body surface smaller than ventral scales (character DO), smooth unpigmented or poorly pigmented ventral scales on body surface (character VE), smooth and pigmented subcaudal scales (character SC), triangle-shaped mental scale (character ME), large first postmental scales in contact for more than the 50% of their length (character 1PM).
Among species of the genus Paragehyra, P. felicitae is the most similar to P. tsaranoro sp. nov., from which it differs in the following four morphological characters: TDL, enlarged tubercles present on the entire dorsal surface of hind limbs and only on distal dorsal segments of forelimbs (vs enlarged tubercles present on the entire dorsal surface of both hind limbs and forelimbs); C, lateral chin scales extend forward along each side, excluded from contact with first line of infralabials and first postmentals, in contact with second line of infralabials (vs lateral chin scales extend forward along each side, excluded from contact with first line of infralabials and first postmentals, in contact with second line of infralabials or lateral chin scales extend forward along each side, excluded from contact with first infralabials, in contact with first postmentals and sec- ond infralabials); SPP five or six large scales on preaxial ventral portion of pes between end of tibia and base of digit | (vs generally 6-9 large scales on preax- ial-ventral portion of pes between end of tibia and base of digit |); SSC, 4-6 sub- digital scales on claw-bearing segment of digits II-V of manus and pes with the distalmost scale markedly larger than the others (vs 4-6 large and subequal subdigital scales on claw-bearing segment of digits II-V of manus and pes).
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 15
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
is. B C ME 1PM 2PM C
BSN
TDL forelimb | TDL hindlimb J
se
Figure 6. Diagnostic morphological characters of Paragehyra tsaranoro sp. nov. Part of non-diagnostic characters are also shown (SL, 2PM, SLMP and SCE; Suppl. material 2), but state descriptions are provided only for diagnostic characters and non-diagnostic SLMP (Tables 1, 4). Pictures taken from the holotype ZSM 11/2023 (ACZCV765) with the exception of C, E, G-l, taken from the paratype ZSM 10/2023 (ACZCV600) A |, 6-8 enlarged infralabials gradually decreasing in size posteriorly B ME, triangle-shaped mental scale; 1PM, large first postmental scales in contact for more than the 50% of their length; C, lateral chin scales extend forward along each side, excluded from contact with first line of infralabials and first postmentals and in contact with second line of infralabials C SLMP 8, 8, 9, 8 transversely enlarged subdigital lamellae on claw-bearing segment digits II-V (left manus in the picture) D SPP five or six large scales on preaxial ventral portion of pes between end of tibia and base of digit | (right pes in the picture) E SS, two or three small subdigital scales between enlarged basal scales and distal pad on digit | of manus and pes (left manus in the picture) F SSC, 4-6 subdigital scales on claw-bearing segment of digits II-V of manus and pes with the distalmost scale markedly larger than the others (digit III of left pes in the picture) G BT, 12 distinct longitudinal rows of enlarged tubercles on the body dorsolateral surface H, | TDL, enlarged tubercles on the entire dorsal surface of hind limbs and on distal dorsal portions of forelimbs J VET, 3-6 ventral scales on the distal (tibial) segments of hind limbs enlarged into plates especially in the most distal part K DO, smooth dorsal scales on body surface smaller than ventral scales L VE, smooth unpigmented or poorly pigmented ventral scales on body surface M TT, enlarged tubercles organised in transversal rows that encircle tail dorsolateral surface N SC, smooth and pigmented subcaudal scales.
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 16
Francesco Belluardo et al.: Anew gecko species of the genus Paragehyra
Table 4. Morphological diagnostic characters of the genus Paragehyra. In bold are different character states relative to P. tsaranoro sp. nov. The state definition of characters C, VET, SPP DO, and ME of P. felicitae has been updated relative to the species description (Crottini et al. 2015) following the morphological inspection of the two recently collected voucher specimens (Table 1, Suppl. material 1). See Morphological measurements for character definitions.
Character
BT
TDL
TT
VET
SPP
SS
SSC
DO
VE
SC
ME
1PM
P. tsaranoro sp. nov. P. felicitae
12 longitudinal rows of
enlarged tubercles on
dorsolateral surface of body
Presence of enlarged tubercles on the entire dorsal surface of hind
limbs and on distal dorsal segments of forelimbs
12 longitudinal rows of enlarged tubercles on dorsolateral surface of body
Presence of enlarged tubercles on dorsal surface of limbs
Transverse rows of enlarged tubercles encircle dorsolateral surface of tail
Transverse rows of enlarged tubercles encircle dorsolateral surface of tail
6-8 enlarged infralabials diminish gradually in size posteriorly
7-9 enlarged infralabials diminish gradually in size posteriorly Lateral chin scales extend forward along each side, excluded from contact with from contact with first first line of infralabials and infralabials and first first postmentals, in contact postmentals, in contact | with second line of infralabials
with second infralabials | or lateral chin scales extend forward along each side, excluded from contact with first infralabials, in contact with first postmentals and second infralabials
Lateral chin scales extend forward along each side, excluded
6-7 ventral scales on distal (tibial) segment of hind limb enlarged into plates, especially distally
3-6 ventral scales on distal (tibial) segment of hind limb enlarged into plates, especially distally
5 or 6 large scales on preaxial-ventral portion of pes between end of tibia and base of digit |
Generally 6-9 large scales on preaxial-ventral portion of pes between end of tibia and base of digit | 2 or 3 small subdigital | 2 or3 small subdigital scales scales between enlarged | between enlarged basal scales basal scales and and terminal distal pad on digit terminal distal pad and | of manus and pes digit | of manus and pes
4-6 subdigital scales on claw-bearing segment of digits II-V of manus
and pes with distalmost scale markedly larger
than the others
4-6 large and subequal subdigital scales on claw- bearing segment of digits II-V of manus and pes
Smooth dorsal scales on body surface smaller than ventrals
Smooth dorsal scales on body surface equal or smaller in size than ventrals Smooth unpigmented or poorly pigmented ventral scales on body surface
Smooth unpigmented or poorly pigmented ventral scales on body surface
Smooth pigmented subcaudal scales
Smooth pigmented subcaudal scales Triangle-shaped mental scale
Triangle-shaped or bell-shaped mental scale
Large first large postmental scales in contact for more than 50% of their length
Large first postmental scales in contact for more than 50% of their length
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016
P, petiti 10 longitudinal rows of enlarged tubercles on dorsolateral surface of body
Presence of enlarged tubercles on the entire dorsal surface of hind
limbs and on distal dorsal segments of forelimbs
Transverse rows of enlarged tubercles encircle dorsolateral surface of tail
First 4-6 infralabials much larger than remainders
Lateral chin scales extend forward along each side, excluded from contact with first infralabials and first postmentals, in contact with second infralabials
5 or 6 enlarged ventral scales on distal (tibial) segment of hind limb
5 large scales on preaxial- ventral portion of pes between end of tibia and base of digit |
2 or 3 small subdigital scales between enlarged basal scales and terminal
distal pad on digit | of
manus and pes
4-6 large and subequal subdigital scales on claw- bearing segment of digits
ll-V of manus and pes
Smooth dorsal scales on body surface smaller than ventrals Smooth unpigmented or poorly pigmented ventral scales on body surface Smooth unpigmented subcaudal scales Bell-shaped mental scale
Large first postmental scales in contact for more than 50% of their length
P. gabriellae
Small tubercles not arranged in distinct rows
Absence of enlarged
tubercles on dorsal surface
of limbs
Presence of enlarged tubercles on tail not organised in transverse rows 8-10 enlarged infralabials diminish gradually in size posteriorly
Lateral chin scales extend
forward along each side in contact with first and second infralabials and with first postmentals or
P. austini
No tubercles on dorsolateral surface of
body
Absence of enlarged tubercles on dorsal surface of limbs
Absence of tubercles on dorsolateral surface of tail
8 or 9 enlarged infralabials diminish gradually in size posteriorly Lateral chin scales extend forward along each side,
excluded from contact with
first infralabials and first postmentals, in contact
lateral chin scales excluded) with second infralabials
from contact with first infralabials, in contact
with first postmentals and
second infralabials
Ventral scales on distal (tibial) segment of hind limb of normal size compared with scales on the proximal segments of hind limbs
7-9 small scales along preaxial-ventral border of pes between end of tibia
and base of digit |
7-10 small subdigital scales between enlarged basal scales and terminal
distal pad on digit | of
manus and pes
Numerous small scales
increasing gradually in size
distally
Smooth dorsal scales on
Ventral scales on distal (tibial) segment of hind limb slightly larger compared with scales on the proximal segments of hind limbs
Generally 7 small scales on preaxial-ventral portion of pes between end of tibia and base of digit |
3 or 4 small subdigital scales between enlarged basal scales and terminal
distal pad on digit | of
manus and pes
3-7 subdigital scales on
claw-bearing segment of
digits II-V of manus and
pes with distalmost scale
markedly larger than the others
Smooth dorsal scales on
body surface equal in size | body surface equal in size
than ventrals
Smooth pigmented ventral
scales on body surface
Smooth pigmented subcaudal scales
Triangle-shaped mental scale
Large first postmental
than ventrals
Smooth pigmented ventral
scales on body surface
Smooth pigmented subcaudal scales
Triangle-shaped mental scale
Large first postmental
scales in contact for 50% or | scales in contact for more
less of their length
than 50% of their length
17
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Paragehyra tsaranoro sp. nov. differs from P. petiti in the following five char- acters: BT, 12 (vs 10) distinct longitudinal rows of enlarged tubercles on dor- solateral body surface; I, 6-8 enlarged infralabials that diminish gradually in size posteriorly (vs first 4-6 infralabials much larger than remainders); SSC, enlarged tubercles present on the entire dorsal surface of hind limbs and only on distal dorsal segments of forelimbs (vs 4-6 large and subequal subdigital scales on claw-bearing segment of digits II-V of manus and pes); SC, smooth and pigmented subcaudal scales (vs smooth and unpigmented subcaudal scales); ME, triangle-shaped mental scale (vs bell-shaped mental scale).
Paragehyra tsaranoro sp. nov. differs from P. austini for the following eight characters: BT, 12 distinct longitudinal rows of enlarged tubercles on dorsolat- eral body surface (vs absence of any tubercle on dorsolateral body surface); TDL, enlarged tubercles present on the entire dorsal surface of hind limbs and only on distal dorsal segments of forelimbs (vs absence of enlarged tuber- cles on limbs dorsal surface); TT, transverse rows of enlarged tubercles that encircle tail dorsolateral surface (vs absence of tubercles on tail dorsolateral surface); VET, 3-6 ventral scales on the distal (tibial) segments of hind limbs enlarged into plates especially in the most distal part (vs ventral scales on distal (tibial) segment of hind limb slightly larger compared with scales on the proximal segments of hind limbs); SPP five or six large scales on preaxial ventral portion of pes between end of tibia and base of digit | (vs generally 7 small scales on preaxial-ventral portion of pes between end of tibia and base of digit I); SS, two or three small subdigital scales between enlarged basal scales and terminal distal pad on digit | of manus and pes (vs 3 or 4 small subdigital scales between enlarged basal scales and terminal distal pad on digit | of manus and pes); DO, smooth dorsal scales on body surface smaller than ventral scales (vs smooth dorsal scales on body surface equal in size than ventrals); VE, smooth unpigmented or poorly pigmented ventral scales on body surface (vs smooth pigmented ventral scales on body surface).
Paragehyra tsaranoro sp. nov. differs from P. gabriellae in the following 11 characters: BT, 12 distinct longitudinal rows of enlarged tubercles on dorsolat- eral body surface (vs presence of small tubercles not arranged in distinct rows); TDL, enlarged tubercles present on the entire dorsal surface of hind limbs and only on distal dorsal segments of forelimbs (vs absence of enlarged tubercles on limbs dorsal surface); TT, transverse rows of enlarged tubercles that en- circle tail dorsolateral surface (vs presence of enlarged tubercles on tail not organised in transverse rows); C, lateral chin scales extend forward along each side, excluded from contact with first line of infralabials and first postmentals, in contact with second line of infralabials (vs lateral chin scales extend forward along each side in contact with first and second infralabials and with first post- mentals or lateral chin scales excluded from contact with first infralabials, in contact with first postmentals and second infralabials); VET, 3-6 ventral scales on the distal (tibial) segments of hind limbs enlarged into plates especially in the most distal part (vs ventral scales on distal (tibial) segment of hind limb of normal size compared with scales on the proximal segments of hind limbs); SPP five or six large scales on preaxial ventral portion of pes between end of tibia and base of digit | (vs 7-9 small scales along preaxial-ventral border of pes between end of tibia and base of digit 1); SS, two or three small subdigi- tal scales between enlarged basal scales and terminal distal pad on digit | of
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 18
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
manus and pes (vs 7-10 small subdigital scales between enlarged basal scales and terminal distal pad on digit | of manus and pes); SSC, 4-6 subdigital scales on claw-bearing segment of digits II-V of manus and pes with the distalmost scale markedly larger than the others (vs numerous small scales increasing gradually in size distally); DO, smooth dorsal scales on body surface smaller than ventral scales (vs smooth dorsal scales on body surface equal in size than ventrals); VE, smooth unpigmented or poorly pigmented ventral scales on body surface (vs smooth pigmented ventral scales on body surface); 1PM, large first postmental scales in contact for more than the 50% of their length (vs large first postmental scales in contact for 50% or less of their length).
Description of the holotype. Figs 3A, 5, 6; Table 1; Suppl. material 2. The ho- lotype is an adult male in well-preserved condition with intact and original tail. Hemipenes are not everted. Digit Ill of the right pes was clipped and stored in 96% ethanol as tissue sample for molecular analyses.
The specimen has flattened body and head. Head width is slightly lower than body width (11.95 mm vs 13.65 mm). The head snout is rounded, with HL and HW that are 0.32 and 0.21x SVL, respectively. Head is 1.52 longer than wider (HL/HW), 3.3x longer than deeper (HL/HD), and 2.17 larger than deeper (HW/HD). Eye with vertical pupil and ED that is 0.29 relative to SnL and 0.66x the IOD. Ear openings are elliptical in vertical direction with a di- ameter on the horizontal axis (EO) that is 0.33x the ED and 5.05 mm distant from the eye (ETD). Forelimb and hind limb lengths are 0.32 and 0.48x SVL, respectively. Forelimbs and hind limbs lengths are 0.72 and 1.08x the AGD, respectively. Forelimb when extended forward reaches nostril, when extend- ed posteriorly reaches three quarters of distance to groin, hind limb reaches anterior axilla. Tail length is 1.24x SVL. The tail is subcylindrical and dorso- ventrally flattened at its base with a pointed and narrow tip.
A concave groove is present between nasal scales, which are not in direct contact, separated by one IN. Nostrils in contact with rostral, nasals, and four postnasals, not in contact with first supralabials. Quadrangular rostral scale less wide than mental scale with an incomplete, dorsal vertical groove extend- ing downward approximately one-half the distance from dorsal edge to lip. Nine enlarged supralabial scales (mostly rectangular) are present on both right and left sides (SL), and eight and seven infralabial scales (I) are on the right and left sides, respectively. Infralabials gradually decrease in size posteriorly. The first six supralabials are squared and have equal size, while the last three scales are much smaller and elongated in posterior direction. Triangle-shaped ME lateral- ly in contact with the first line of infralabials. Posterior to the mental scale are two large 1PM with irregular pentagonal shapes and in reciprocal contact for more than 50% of their length. The first postmentals are bordered posteriorly by a line of six smaller polygonal scales (2PM, which are clearly distinguishable from the much smaller and mostly granular chin scales that are posterior to these) and in contact with the first line of |. Scalation of the contact between chin scales with postmentals and infralabials (C) is variable between left and right sides. On the left side, chin scales extending laterally are excluded from contact with the first line of infralabials and first postmentals and are in contact with the second line of elongated infralabials (defined as a distinguishable line of scales that are larger than chin scales and parallel to the first infralabials). On the right side, chin scales extending laterally are in contact with a third line
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 19
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
of elongated infralabials but excluded from contact with the first and second lines of infralabials and first postmentals. Throat scales small, circular, and largely juxtaposed. Scales just below posterior infralabials enlarged. Throat covered by small granular scales.
Scales on the dorsal body surface are mostly small granular with smooth surface, smaller than ventral scales (approximately half dimension on the hori- zontal axis). Dorsal enlarged body tubercles (~ three times bigger than scales) with rounded or subconical shape that are arranged into 12 distinct parallel longitudinal rows (BT), equally divided between the two body sides. Dorsal scales on limbs are mostly small with granular shape and smooth surface. Body tubercles extend on the entire surface of hind limbs and only on the distal portions of forelimbs (TDL). Hind limbs tubercles are larger than tubercles on forelimbs and larger than the dorsal tubercles organized in the 12 parallel lon- gitudinal rows. A few scattered tubercles are also found on the posterior-lateral portion of the head and the neck. Dorsal scales on the tail are small and gran- ular with smooth surface and of the same size as the dorsal scales on body. Eight dark whorls with one or two transverse rows (ring) of enlarged tubercles of each of the first five dark whorl are alternated until the tail tip with seven paler whorls with two transverse rows (rings) of enlarged tubercles, one at the anterior and one at the posterior border of each of the first four pale whorl. En- larged tubercles on tail are larger than the dorsal tubercles organised in the 12 parallel longitudinal and the enlarged tubercles present of limbs. Whorl 1 and 2 have 12 enlarged tubercles, whorls 3 and 4 have six enlarged tubercles, whorls 5 and 6 have four enlarged tubercles, whorl 7 has three enlarged tubercles, whorl 8 has two enlarged tubercles, whorl 9 has a single enlarged tubercle. The two distalmost pale whorls are lighter than the previous ones. Dark whorls size increases in posterior direction. Pale whorl size increases in posterior direction until the fourth pale whorl, with the remaining three pale whorls gradually de- creasing towards the tail tip. Transverse rows of enlarged tubercles with round- ed or subconical shape encircle the tail dorsolateral surface (TT). Tubercle size gradually decreasing in posterior direction.
Scales on the body ventral surface are mostly regular rhombus-shaped and juxtaposed with smooth surface (VE). They are unpigmented or poorly pigmented (pigments are visible only under stereo microscope). Slightly im- bricate, cycloid scales begin behind throat and cover chest and belly. Ventral surface of forelimbs covered with granular scales on proximal segment and imbricate cycloid scales on distal segment. Hind limbs have mostly large polyg- onal and slightly imbricate scales with smooth surface and unpigmented to the naked eye, as described above for the ventral body surface. Some pale scale pigmentation is only visible on belly. Ventral surface of pelvis and thigh (proxi- mal portion of hind limbs) covered with imbricate cycloid scales. Scales on the hind limbs distal (tibial) portion are larger than on the proximal portion. They gradually increase in size towards pes, and the three distalmost form large plates (VET) as large as half the limb width. Subcaudal scales are enlarged transversely, smooth, and pigmented, especially in their anterior and posterior borders (SC). In the distalmost part of the tail, they tend to be pigmented also in their central portions and follow the alternated dark and pale colour pattern of the dorsal whorls described above. In the proximal portion of the tail, there are three central longitudinal rows of large imbricate and mostly cycloid scales
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 20
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
and, starting from the section corresponding to the second dark dorsal whorl and in posterior direction, they form a unique longitudinal row of imbricate un- divided plates almost as large as the tail width. These central longitudinal rows are laterally bordered on both sides by 1 to 3 longitudinal rows of smaller im- bricate cycloid scales. Scales immediately adjacent to cloacal opening much smaller than surrounding scales. Precloacal or femoral pores are absent.
Preaxial border of palm and digit | of manus covered with large scales. The pes palm is covered with mostly granular scales in their central part and rela- tively large cycloid imbricate scales on the lateral portions. In particular, on the pes preaxial ventral portion between the end of the tibia and the base of digit | there is a longitudinal row of five (right) and six (left) large imbricate cycloid scales with smooth surface on pes (SPP). Subdigital scalation of digit | of manus and pes organised into a basal longitudinal row of relatively large imbri- cate scales on the proximal portion, followed by two intermediate parallel rows of smaller juxtaposed scales (composed of three scales on left manus and pes; SS), and a distal enlarged rectangular pad with an extremely small claw (only visible with a stereo microscope) on top of it. Mostly imbricate cycloid scales on basal portions of digits II-V of manus and pes followed by rows of undivided and transversely enlarged pads covering the distal two-thirds of digits. Lamellae cover the most distal pads of digits II-V with the following numbers on the left side: 6, 7, 7, 7 pads (manus), 8, 8, 7, 7 pads (pes) (SLMP). Claw-bearing segments on top of the subdigital lamellae composed of rela- tively large imbricate rectangular scales organised into longitudinal rows with some degree of overlap between them. In the central row, the distalmost scale is markedly larger than the others and composed of the following scale num- bers on left digits II-V: 5,5,5,5 (manus) and 5,6,5,5 (pes) (SSC). Comparative finger and toe length in manus is 1<2<5<3<4, in pes 1<2<3<4<5.
Colouration. Colouration after six years in ethanol is slightly paler but with an identical pattern to that at the time of collection (Figs 3A, 5, 6). Dorsolat- eral surface of the head, body, limbs, and tail with a pale grey ground colour and dark brownish transversal bands and blotches. Head with large posterior blotches and scattered dark brownish dots and linear marks until the mouth tip. A dark brownish line connects ear openings to the eyes posteriorly and reaches half of the distance between the eye anterior parts and nostrils, on both sides. Brownish longitudinal vertebrate line on the dorsal body surface. Five transversal dorsolateral dark brownish blotches on the dorsal body sur- face with a paler greyish spot in their centre. Hind limbs with transverse bands that are more defined in their distal (tibial) rather than proximal portions, where they can be more similar to blotches. Forelimbs with less defined transverse bands with interspersed brownish blotches. Dorsal surface of digits with two pale grey and two dark brownish bands alternated from the base until the tip; in life colouration, the second pale band towards the distal portion is white. In the preserved specimen the tail has alternated dorsolateral pale grey and dark brownish transverse bands. The ventral surface of the head, body, limbs, and tail is uniformly pale brownish tending to whitish, for the presence of a sparse dotted dark pigmentation visible only under stereo microscope (character VE; Fig. 6). Ventral (subdigital) surface of digits is slightly darker than ground co- lour, and lamellae are white. Subcaudal scales borders are slightly darker than the ground colour. The distal part of the tail (ca one-third of the entire length)
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 21
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
has alternated dark brownish and ground colour bands, and the tip is black. Supralabials and infralabials with alternated whitish and dark brownish vertical bands, with more intense dark colouration on supralabials (Fig. 6).
Variation. Variation in morphological characters of ZSM paratypes is report- ed in Table 1 and Suppl. material 2 (see also Fig. 3). After six years in etha- nol, colouration of the paratypes ZSM 10/2023 (ACZCV600) and ZSM 12/2023 (ACZCV809) is slightly paler to that in life and overall similar to the holotype. Paratype ZSM 10/2023 (ACZCV600) differs from the holotype in the following characters: nasal scales are in contact, 11 enlarged left supralabials (SL), six left |, eight 2PM, scalation of chin scales identical between right and left sides with lateral chin scales extending forward excluded from contact with first line of infralabials and first postmentals but in contact with second line of infralabi- als (C), six plates on ventral side of distal (tibial) segments of hind limbs (VET), and two scales compose the intermediate longitudinal rows between enlarged basal scales and distal pad of digit | of pes (SS). Refer to Table 1 and Suppl. ma- terial 2 for the variation in morphological measurements and in SSC and SLMP. The head dorsal surface is slightly darker than in the holotype, with a character- istic pale W-shaped blotch posterior to the eyes and two central pale spots an- terior to the eyes. The specimen does not have the tail, and the third digit of the right pes was clipped as tissue sample. Paratype ZSM 12/2023 (ACZCV809), an unsexed juvenile, differs from the holotype in the following characters: nasal scales are in contact (IN), 10 enlarged left SL, eight right |, modified bell-shaped ME, eight second 2PM, scalation of chin scales identical between right and left sides with lateral chin scales extending forward excluded from contact with first line of infralabials and first postmentals but in contact with second line of infralabials (C), four plates on ventral side of distal (tibial) segments of hind limbs (VET), six scales on preaxial-ventral portion of right pes between end of tibia and base of digit | (SPP), and two scales make the intermediate longitu- dinal rows between enlarged basal scales and distal pad of digit | of manus (SS). Refer to Table 1 and Suppl. material 2 for the variation in morphological measurements and in the number of subdigital scales and subdigital lamellae on claw-bearing segments of digits II-V (SSC and SLMP respectively). Morpho- logical variation and measurements are not available for the paratypes hosted in the UADBA collection: UADBA uncatalogued (ACZCV810), UADBA uncata- logued (ACZCV771), UADBA uncatalogued (ACZCV770), and UADBA uncata- logued (ACZCV779).
Etymology. The specific epithet derives from the type locality Tsaranoro. The name is used as an invariable noun in apposition to the generic name.
Distribution. Paragehyra tsaranoro sp. nov. is currently known from south-eastern Madagascar, restricted to three localities within the western part of the region surrounding the Andringitra Massif (Haute Matsiatra administra- tive region, Fianarantsoa province): Tsaranoro, Ambatomainty, and lantaranom- by (Suppl. material 1; Figs 1, 2). lantaranomby is on the western slope of the An- dringitra Massif, while Tsaranoro and Ambatomainty forests are in the plateau located west to the Massif, laying at the foot of two granitic domes rising a few hundred meters relative to ground elevation. The species has been sampled within an elevation range between 897 m (Ambatomainty) and 1,610 m a.s.I. (lantaranomby).
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 22
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Habitat and behaviour. The holotype ZSM 11/2023 (ACZCV765) was found at night (~ 8 p.m.) in the semi-deciduous forest fragment of Tsaranoro under clear weather. The animal was resting on a boulder near the forest edge. Nearby, we sampled an individual of Paroedura rennerae Miralles, Bruy, Crottini, Rako- toarison, Ratsoavina, Scherz, Schmidt, K6hler, Glaw & Vences, 2021 (Belluardo et al. 2021a). The remaining individuals of P. tsaranoro sp. nov. from Tsaranoro forest were found on boulders. Paratype UADBA uncatalogued (ACZCV771) was collected outside the forest patch along a small stream amidst arboreal riverine vegetation. The other two paratypes, UADBA uncatalogued (ACZCV770 and ACZCV779), were found within the forest interior, along with additional in- dividuals not collected as vouchers (Suppl. material 1). All Tsaranoro animals were found at night, except for ACZC10973, collected in the morning (~ 9 a.m.). Paratype ZSM 10/2023 (ACZCV600) was the only individual collected within Andringitra NP (lantaranomby, ca 400 m from the park limit; Fig. 2C). This ani- mal was found at night in clear weather under a large boulder on a sloping trail surrounded by scattered palm trees. The three individuals from Ambatomainty Tsiomba (including the paratypes UADBA uncatalogued (ACZCV810) and ZSM 12/2023 (ACZCV809)) were all found outside the small forest patch (Fig. 2A). These animals were sampled at night in clear weather on large boulders in open areas near the forest fragment surrounded by scattered trees.
Overall, P. tsaranoro sp. nov. seems to be associated with semi-deciduous forest. The species is found both within the forest interior and along its edges, as well as outside the forest or along water streams, but always on boulders asso- ciated with arboreal vegetation. The isolated forest fragments in the study area are characterised by numerous boulders, many of which are ancient Betsileo tombs (Gould and Andrianomena 2015). This cultural significance has led to these areas being referred to as “Foréts sacrées’, i.e., “sacred forests”. The boul- ders vary in size, sometimes forming large agglomerates, with some reaching considerable dimensions. The higher number of individuals found in the interior of Tsaranoro forest compared to other sites suggests that relatively larger and more mature forests may support higher population densities of this species.
Proposed conservation status. The extent of occurrence (EOO) and area of occupancy (AOO) total 38.8 km? and 16 km?, respectively (computed with GeoCAT (Bachman et al. 2011) using squared grid cells of 2 x 2 km for AOO). Following IUCN Red List guidelines (IUCN Standards and Petitions Committee 2024), we propose to consider P. tsaranoro sp. nov. as Critically Endangered (CR) under criterium B1ab(iii). The proposed evaluation of the species conser- vation status is justified by the narrow distribution (EOO < 100 km7), its oc- currence at three severely isolated localities, and the continuing decline in the extent and quality of its habitat due to specific threats.
The habitat of this species is severely fragmented, with the three known lo- calities isolated by unsuitable landscapes of villages, rice fields, and pastures. In two of these localities, forests areas and arboreal vegetation are heavily de- graded. The Ambatomainty forest is extremely small (ca 2 ha) with almost no canopy cover. In lantaranomby (Andringitra NP), the single specimen encoun- tered was found in an area with only a few scattered palm trees. Unlike Ambato- mainty and lantaranomby, Tsaranoro forest provides particularly favourable conditions for the species, featuring well-structured vegetation and abundant
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 23
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
boulders. Tsaranoro is also the largest forest fragment in the region (46 ha; Gould and Andrianomena 2015; Gould and Gabriel 2015), likely contributing to the higher abundance of the species observed there.
lantaranomby is the only locality with formal legal protection, located within An- dringitra NP borders. No legal protection or local management is known for Ambato- mainty. Tsaranoro forest is managed by the local community Association Tantely since 2002. Although in the past the forest has been subject to selective logging (Gabriel et al. 2018), reforestation projects consisting in the establishment of tree nurseries have been recently funded (Gould and Andrianomena 2015). However, and apart from Tsaranoro, deforestation in the region has been particularly intense and seems to be a recent and still ongoing process. Most deforestation occurred in the last 60 years and until 20 years ago there were still remnant parts of continuous forests (Gould and Andrianomena 2015; Gould and Gabriel 2015). The process of deforestation and forest degradation in the region is continuing through direct tree logging (normally used as firewood) and fires that are normally used to clean areas for cattle grazing and that sometimes go out of control and affect the remaining forest fragments (Crottini et al. 2015; Gould and Andrianomena 2015; Gould and Gabriel 2015). We could directly observe these activities in some of these frag- ments, even within the legally protected area of Andringitra NP. Ongoing deforesta- tion, forest degradation, and fragmentation seem to be the main threats to the con- servation of the small forest fragments where P. tsaranoro sp. nov. lives and their persistence is expected to have an impact on this newly described gecko species.
Updated distribution and proposed conservation status of P felicitae. When P. felicitae was formally described, the species was only known from its type local- ity within Anja reserve and a few boulders located ca 1 km away, on the opposite side of the national road RN7 relative to the reserve (Fig. 2F; Suppl. material 1; Crot- tini et al. 2015). Due to the limited knowledge of the species distribution within the areas surrounding Anja and following IUCN Red List guidelines, Crottini et al. (2015) proposed to consider the species as Data Deficient. During the herpetological sur- vey conducted by Belluardo et al. (2021a) in several localities of the Andringitra region, including several areas surrounding Anja, the species was confirmed within Anja reserve and a few individuals were found in the forest of Sakaviro reserve (Fig. 2E; Suppl. material 1), located ca 8 km north of Anja (Fig. 1). The semi-decidu- ous forest in Sakaviro is smaller than in Anja (14 vs 36 ha, Gould and Andrianome- na 2015), and host similar environmental characteristics, being located at the base of a small granitic peak and with the presence of several large granitic boulders. Species elevation ranges between 950 m (Anja) and 1,089 m a.s.I. (Sakaviro).
With the improved knowledge on the species distribution in the region sur- rounding the type locality, it is now possible to propose a new conservation status for P. felicitae. The updated EOO and AOO total 5 km? and 16 km%, re- spectively. The EOO has been adjusted to 16 km? as it cannot be smaller than AOO (IUCN Standards and Petitions Committee 2024). Although smaller grid cells might produce lower and more realistic AOO extents, we followed IUCN Red List guidelines in using 2 x 2 km cells. We propose to evaluate this species as CR under criterium B1ab(iii) based on the narrow distribution (EOO < 100 km?), the occurrence at three isolated threat-defined locations (Anja reserve, the few boulders located at ca 1 km away from Anja and Sakaviro reserve), and the continuing decline in the extent and quality of its habitat due to persistent deforestation and forest degradation in the surrounding areas.
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 24
Francesco Belluardo et al.: Anew gecko species of the genus Paragehyra
Similar to P. tsaranoro sp. nov., P. felicitae seems to be associated with granitic boulders within or close to semi-deciduous forest (Crottini et al. 2015). Despite their limited extensions, both Anja and Sakaviro forests seem to host suitable habitats and the species was found to be relatively abundant in both localities. Anja and Sakaviro forests are managed by local community associ- ations: Anja Miray (since 2000) and Sakaviro Miray (since 2012), respective- ly (Gould and Andrianomena 2015). Anja forest has been subject to selective logging and introduction of non-native trees before the community-managed reserve became established (Gabriel et al. 2018). Some human disturbance at the forest edge (i.e., tree logging and cattle grazing) has been observed (Crotti- ni et al. 2015), suggesting that some level of forest use for livelihood resource remains, as expected in community-managed forests (Raik 2007; Nopper et al. 2017). The combination between severe habitat fragmentation and continued widespread deforestation within the region surrounding Anja and Sakaviro and some level of human disturbance in these forests (Crottini et al. 2015; Gould and Andrianomena 2015; Gould and Gabriel 2015) represent the main threats to P. felicitae and might seriously impact the viability of local populations caus- ing the long-term decline of the species.
Discussion
The genus Paragehyra has been poorly studied compared to other species-rich genera of Malagasy geckos (e.g., Miralles et al. 2021; Vences et al. 2022b; Pic- coli et al. 2023; see Bauer et al. 2022; Gehring and Ratsoavina 2022; Gehring et al. 2022), and the phylogenetic relationships of this genus in relation to other gekkonids from Madagascar and from the rest of the world remain substantial- ly unresolved (Gamble et al. 2015; Zheng and Wiens 2016; Bauer et al. 2022). After two taxonomic revisions and the description of new species, four nominal species were included in the genus Paragehyra until now (Nussbaum and Rax- worthy 1994; Crottini et al. 2015; Uetz et al. 2025). In this study, we described P. tsaranoro sp. nov., anew microendemic species from the western part of the Andringitra Massif region. We justified the description of P. tsaranoro sp. nov. following an integrative taxonomic approach combining multiple lines of evi- dence (Padial et al. 2010). At the genetic level, the large uncorrected p-distances of mitochondrial markers (16S and COl) and the absence of haplotype sharing at the POMC nuclear marker differentiated P. tsaranoro sp. nov. from congeneric species (Table 3; Fig. 4). At the morphological level, the species is distinguish- able from all other congeneric species by a combination of 14 morphological characters (Tables 1, 4). We also provided new genetic and morphological data of P. felicitae from newly collected tissue samples and voucher specimens (Tables 1, 3, Suppl. materials 1, 2, Fig. 4; Belluardo et al. 2021a). These new data enabled us to update the state definitions of the characters C, VET, SPP DO and ME relative to the species description (Table 4; Crottini et al. 2015).
The record of P. tsaranoro sp. nov. from lantaranomby extends by ca 600 m the upper elevational limit of the genus, which now ranges from 15 ma.s.l. (P. gabriellae from Manantantely; Suppl. material 1) to 1,610 m a.s.I., suggesting that despite the limited species richness, Paragehyra geckos are adapted to a relatively wide range of temperatures and climatic conditions. Similarly, the records from Sakaviro extend the upper limit of the elevational range of P. fe-
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 25
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
licitae from 1,000 m a.s.l. (so far considered the highest record of the genus; Crottini et al. 2015) to 1,089 maz.s.I. (Suppl. material 1).
In our phylogeny, the inter-specific relationships within the genus Paragehyra (Fig. 4B) agree with the previous phylogenetic hypothesis inferred by Crottini et al. (2015) based ona larger multi-locus dataset of mitochondrial and nuclear mark- ers. However, differently from this study, in our analysis the sister relationship between P. austini and P. gabriellae was statistically supported, while we could not retrieve support for the monophyly of the genus. Interestingly, the reciprocal closest morphological similarity between P. felicitae and P. tsaranoro sp. nov. (Table 4) is not reflected at the genetic and phylogenetic level (Table 3; Fig. 4), where P. felicitae shows the lowest distances and closest phylogenetic position to P. petiti (Table 3; Fig. 4). While all Paragehyra species have similar rupicolous microhabitat preferences (Glaw and Vences 2007; Crottini et al. 2015), the two main sub-clades have clear distinct macroclimatic and macrohabitat preferenc- es: P. austini and P. gabriellae inhabit humid forests, while the subclade com- posed of P. felicitae, P. petiti, and P. tsaranoro sp. nov. lives in more arid habitats. When Nussbaum and Raxworthy (1994) described P. gabriellae and re-described P. petiti, they suggested that, given the more plesiomorphic condition of P. ga- briellae (based on morphological data), it was likely that the common ancestor of the genus inhabited humid forests, as does P. gabriellae. However, after the descriptions of P. austini, P. felicitae (Crottini et al. 2015), and P. tsaranoro sp. nov., we can propose a different hypothesis. Assuming that the current species macrohabitat preferences and distributions are indicative of the mechanisms responsible for the diversification of the genus, we can hypothesise that their common ancestor was ecologically tolerant and widespread between eastern humid and western and central drier areas of the island and that, over time, pop- ulations living in the two distinct macrohabitats diverged into separate species following adaptive speciation in allopatry, and later diverged into the species that are now part of the two main subclades. This mechanism is known as “Ecogeo- graphic constraint” and is among the main processes that have been proposed to explain the diversification of Malagasy vertebrate fauna (Yoder and Heckman 2006; Vences et al. 2009). Considering that both P. felicitae and P. tsaranoro sp. nov. inhabit semi-deciduous forests at mid-high altitudes, it is possible that the common ancestor of their subclade (which also includes P. petiti) had similar habitat preferences. The diversification in this sub-clade might have occurred in allopatry (as suggested by Crottini et al. 2015), with P. petiti specialising in oc- cupying coastal calcareous areas in south-western Madagascar and P. felicitae and P. tsaranoro sp. nov. that came later into secondary sympatric contact.
Paragehyra felicitae and P. tsaranoro sp. nov. live in the same region at ca 20 km of distance. We cannot exclude that future investigations in the same area might uncover new geographic records and even syntopic localities where the two species live in direct contact, although the high levels of forest loss and frag- mentation in the region (Gould and Andrianomena 2015; Gould and Gabriel 2015) do not facilitate the identification of contact zones. Despite their limited exten- sions and isolation, the forest fragments in this area host a remarkable herpeto- logical diversity (Belluardo et al. 2021a). During the recent survey conducted by Belluardo et al. (20214), six reptile species previously unknown from the region of the Andringitra Massif were found in the same forest fragments as P. felicitae and P. tsaranoro sp. nov. Among these, probably the records of the chameleon
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 26
Francesco Belluardo et al.: Anew gecko species of the genus Paragehyra
Furcifer nicosiai Jesu, Mattioli & Schimmenti, 1999 from Tsaranoro and the snake candidate species Pseudoxyrhopus sp. Ca2 from Ambatomainty represent the most relevant range extensions (ca 300 km and 230 km, respectively; see Bel- luardo et al. 2021a, 2021b). Probably the most important aspect supporting the relevant herpetological value of these forest fragments is the presence of several microendemic species that do not occur in any other part of the country: namely Phelsuma gouldi Crottini, Gehring, Glaw, Harris, Lima & Vences, 2011, Brookesia brunoi Crottini, Miralles, Glaw, Harris, Lima & Vences, 2012, and P. felicitae (original- ly described from Anja; Crottini et al. 2011b, 2012a, 2015), and Paroedura manon- gavato Piccoli, Belluardo, Lob6n-Rovira, Oliveira Alves, Rasoazanany, Andreone, Rosa & Crottini, 2023 from Anja and Tsaranoro (Belluardo et al. 2021a; Miralles et al. 2021; Piccoli et al. 2023). Considering other microendemic species recent- ly described from forest fragments in other parts of the country (e.g., Calumma tarzan Gehring, Pabijan, Ratsoavina, Kohler, Vences & Glaw, 2010 or Calumma ju- liae Protzel, Vences, Hawlitschek, Scherz, Ratsoavina & Glaw, 2018; Gehring et al. 2010; Protzel et al. 2018), this suggests that herpetological research should not overlook regions highly impacted by human activities and mostly lacking legal protection (see also D’Cruze et al. 2009; Vences et al. 2022a). At the same time, the record of P. tsaranoro sp. nov. from Andringitra NP (lantaranomby) demon- strates that even areas that received relatively higher scientific attention still hold the potential to uncover new herpetological diversity (Goodman et al. 2018; Bel- luardo et al. 2021a), suggesting that the inventory of Malagasy reptiles remains incomplete (Nagy et al. 2012; Antonelli et al. 2022; Glaw et al. 2022). Considering the restricted distributions of P. tsaranoro sp. nov. and P. felic- itae, their isolated local populations, and persisting threats to their long-term viability posed by the worsening condition in the extent and quality of their habitat, we proposed to list both species as CR (IUCN Standards and Petitions Committee 2024). The largest forest fragments of the region, which are also the largest patches where the two species are known to exist, are community-man- aged reserves (i.e., Anja, Sakaviro, and Tsaranoro). Despite the possible pres- ence of some level of human disturbance (Crottini et al. 2015), Anja and Tsa- ranoro represent overall successful examples of local forest management and ecotourism promotion, whose monetary benefits contribute to help local com- munities (Gould and Andrianomena 2015). Its location on the RN7, one of the main national roads of the country, and the possibility to easily observe a dense population of Lemur catta Linnaeus, 1758, made Anja one of the most visited community-managed reserves of Madagascar (Crottini et al. 2015; Gould and Andrianomena 2015). Tsaranoro is less easily accessible, but it is on the road to the entrance of the western side of Andringitra NP and has become a renowned destination for rock-climbing and para-gliding (Gould and Andrianomena 2015). In other parts of Madagascar, local management of natural resources has not always been as effective as expected and has not necessarily reduced defor- estation (see Rasolofoson et al. 2015; Gardner et al. 2020; Long et al. 2021). Although forest fragments managed by local communities can host interesting and unique reptile communities, the impact caused by their use for livelihood resources and limited extensions can alter reptile community composition, with rare forest specialists that might disappear over time (Gardner et al. 2016; Nop- per et al. 2017). Forest patches in community-managed reserves cannot have the same conservation value and be alternative to larger and more pristine for-
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 27
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
ests within legally protected areas, such as National Parks, whose main goals are to protect biodiversity (Wright 2010; Nopper et al. 2017). However, they can still play a fundamental role in conserving local herpetofauna, complementary to the national network of protected areas (Jenkins et al. 2014; Nopper et al. 2017). In the case of the region surrounding the Andringitra Massif, the herpeto- logical value of the community-managed reserves (Belluardo et al. 2021a) sug- gests that these forests can actually complement the protection of Andringitra NP by acting as refugia to local herpetofauna in a landscape that is unsuitable for most of its extension. Therefore, any initiative to favour the persistence and improve the effectiveness of these reserves should be strongly supported.
Conclusions
We formally described P. tsaranoro sp. nov., anew Malagasy gecko microendemic to the western part of the Andringitra Massif region. We provided multiple indepen- dent molecular and morphological lines of evidence to justify its distinctness from all other congeneric species. We also provided new genetic and morphological data of P. felicitae. By doing this, we expanded the morphological and molecular datasets of the genus available in Crottini et al. (2015), thus facilitating any future identification of candidate species, the evaluation of their taxonomic status and formal description. However, the knowledge on the genus Paragehyra is still very limited. To test specific diversification hypotheses within a robust statistical frame- work, more fieldwork efforts are needed to collect data on species natural history and improve knowledge on their distribution. Generating additional genetic (and possibly genomic) data might help clarifying the taxonomic identity of the popula- tion of Paragehyra from Tsingy de Bemaraha (Crottini et al. 2015).
We propose to classify both P. tsaranoro sp. nov. and P. felicitae in the CR category of the IUCN Red List (IUCN Standards and Petitions Committee 2024), due to their small EOOs, the high levels of forest loss and fragmentation in the re- gion where these species are found and the continuing decline in the extent and quality of their habitat (Gould and Andrianomena 2015; Gould and Gabriel 2015). The fact that both P. tsaranoro sp. nov. and P. felicitae mostly occur and are apparently more abundant within forests fragments managed by local commu- nities suggest that this form of local management of natural resources can play an important role in the conservation of the regional herpetofauna. The overall herpetological value of these forest fragments (Belluardo et al. 2021a) also sug- gests that even areas impacted by high levels of human pressure and outside the national network of protected areas can host interesting and sometimes irre- placeable levels of herpetological diversity and should not be overlooked by her- petological research in order to complete the cataloguing of Malagasy reptiles.
Acknowledgments
We thank Malagasy authorities, in particular the Ministére de I'Environnement, de I’Ecologie et des Foréts (now Ministére l’Environnement et du Développe- ment Durable) and the Direction Régionale de |’Environnement, de |’Ecologie et des Foréts Haute Matsiatra, for providing the research permit (222/18/ MEEF/SG/DGF/DSAP/SCB.Re), transportation permit (1596/18/MEEF/SG/ DREEF.HM), and exports permits (390N-EA12/MG18; 529C-EA08/MG19).
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 28
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Voucher specimens were euthanised with procedures described in the Mate- rials and methods section and received approval by the Ethics Committee of the Ministére l’Environnement et du Développement Durable (CAFF/CORE). We thank MICET for their logistic support and the several local guides who pro- vided their invaluable support during fieldwork: Meja, Boba Joseph, Francky Rasolondraibe, Francois Rasolomampiandra, and Josef Samuel.
Additional information
Conflict of interest
The authors have declared that no competing interests exist.
Ethical statement
No ethical statement was reported.
Funding
Fieldwork activities were funded by the National Geographic Society (grant number EC- 50656R-18 to FB) and by Portuguese National Funds through FCT (Fundac@o para a Cién- cia e a Tecnologia) with the research project PTDC/BIA-EVL/31254/2017 awarded to AC. Laboratory activities were funded by FCT with the project PTDC/BIA-EVL/31254/201 7. FCT also funded the research contract to AC ([https://doi.org/10.54499/2020.00823. CEECIND/CP1601/CP1649/CT0002] and 2023.08548.CEECIND), the research contract of FB within the project PTDC/BIA-EVL/31254/2017 and the PhD fellowships of FB (PD/ BD/128493/2017), CP (SFRH/BD/144342/2019), and JL-R (PD/BD/140808/2018). The Ministero dell’Universita e della Ricerca (MUR) funded the research contract of FB with Progetti di Rilevante Interesse Nazionale (PRIN) and Piano Nazionale di Ripresa e Re- silienza (PNRR) funds awarded to the University of Molise (CUP: H53D23007200001).
Author contributions
Conceptualization, FB and AC; methodology, AC; validation, FB, CP, l|OA, and AC; formal analysis, FB, CP |OA, and AC; investigation, FB, CP JL-R, |OA, MR, FA, GMR, and AC; re- sources, FB, JL-R, MR, GMR, FA, and AC; data curation, FB and AC; writing—original draft preparation, FB; writing—review and editing, FB, CR JL-R, lOA, MR, FA, GMR, and AC; visualization, FB; supervision, AC; project administration, FB and AC; funding acquisition, FB and AC. All authors have read and agreed to the published version of the manuscript.
Author ORCIDs
Francesco Belluardo © https://orcid.org/0000-0002-3967-2686 Costanza Piccoli © https://orcid.org/0000-0002-1234-5706 Javier Lobé6n-Rovira © https://orcid.org/0000-0003-4380-9427 Ivo Oliveira Alves © https://orcid.org/0009-0000-1187-4211 Franco Andreone ® https://orcid.org/0000-0001-9809-5818 Goncalo M. Rosa ® https://orcid.org/0000-0002-8658-8436 Angelica Crottini © https://orcid.org/0000-0002-8505-3050
Data availability
Research data presented in this study are openly available in the Mendeley Data platform at https://doi.org/10.17632/43sdv5d9k4.1 and include the 16S phylogenetic tree in nexus for- mat and the alignments of 16S, COI, BDNF, and POMC markers used in molecular analyses.
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 29
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
References
Angel F (1929) Description d'un gecko nouveau, de Madagascar. Bulletin de la Société Zoologique de France 54: 489-491.
Antonelli A, Smith RJ, Perrigo AL, Crottini A, Hackel J, Testo W, Farooq H, Torres Jiménez MF, Andela N, Andermann T, Andriamanohera AM, Andriambololonera S, Bachman SP, Bacon CD, Baker WJ, Belluardo F, Birkinshaw C, Borrell JS, Cable S, Canales NA, Carrillo JD, Clegg R, Clubbe C, Cooke RSC, Damasco G, Dhanda S, Edler D, Faurby S, de Lima Ferreira P Fisher BL, Forest F, Gardiner LM, Goodman SM, Grace OM, Guedes TB, Henniges MC, Hill R, Lehmann CER, Lowry PP, Marline L, Matos-Maravi P Moat J, Neves B, Nogueira MGC, Onstein RE, Papadopulos AST, Perez-Escobar OA, Phelps LN, Phillipson PB, Pironon S, Przelomska NAS, Rabarimanarivo M, Rabehevitra D, Ra- harimampionona J, Rajaonah MT, Rajaonary F, Rajaovelona LR, Rakotoarinivo M, Ra- kotoarisoa AA, Rakotoarisoa SE, Rakotomalala HN, Rakotonasolo F, Ralaiveloarisoa BA, Ramirez-Herranz M, Randriamamonjy JEN, Randriamboavonjy T, Randrianasolo V, Rasolohery A, Ratsifandrihamanana AN, Ravololomanana N, Razafiniary V, Raza- najatovo H, Razanatsoa E, Rivers M, Sayol F, Silvestro D, Vorontsova MS, Walker K, Walker BE, Wilkin P Williams J, Ziegler T, Zizka A, Ralimanana H (2022) Madagas- car's extraordinary biodiversity: Evolution, distribution, and use. Science 378(6623): eabf0869. https://doi.org/10.1126/science.abf0869
Avise JC, Ball RM (1990) Principles of genealogical concordance in species concepts and biological taxonomy. In: Futuyma D, Antonovics J (Eds) Surveys in evolutionary biology. Oxford University Press, New York, 45-67.
Bachman S, Moat J, Hill AW, De La Torre J, Scott B (2011) Supporting Red List threat assessments with GeoCAT: Geospatial conservation assessment tool. ZooKeys 150: 117-126. https://doi.org/10.3897/zookeys.150.2109
Bauer AM, Scherz MD, Crottini A, Ratsoavina FM, Glaw F (2022) Gekkonidae, geckos, katsatsaka, tsatsake. In: Goodman SM (Ed.) The new natural history of Madagas- car. Princeton University Press, Princeton-Oxford, Volume 2, 1474-1479. https://doi. org/10.2307/j.ctv2ks6tbb.211
Belluardo F, Quiros DD, Lobon-Rovira J, Rosa GM, Rasoazanany M, Andreone F, Crot- tini A (2021a) Uncovering the herpetological diversity of small forest fragments in south-eastern Madagascar (Haute Matsiatra). Zoosystematics and Evolution 97(2): 315-343. https://doi.org/10.3897/zse.97.63936
Belluardo F, Rosa GM, Andreone F, Courtois EA, Lobon-Rovira J, Nussbaum RA, Raseli- manana M, Rasoazanany M, Raxworthy CJ, Crottini A (2021b) Extending the known distribution of Nicosia’s chameleon, Furcifer nicosiai Jesu, Mattioli & Schimmenti, 1999 (Squamata: Chamaeleonidae). Herpetology Notes 14: 455-460.
Blyth E (1854) Proceedings of the society: Report of the Curator, Zoological Department. Journal of the Asiatic Society of Bengal 23: 737-740.
Boettger O (1879) Diagnosen zweier neuer amphibien aus Madagascar. Bericht Senck- enbergische Naturforschende Gesellschaft Frankfurt a. M. 1878-1879: 85-86.
Bohme W, Meier H (1980) Revision der madagassischen Homopholis (Blaesodacty- lus)-Arten (Sauria: Gekkonidae). Senckenbergiana Biologica 60: 303-315.
Bora P Randrianantoandro JC, Randrianavelona R, Hantalalaina EF, Andriantsimanari- lafy RR, Rakotondravony D, Ramilijaona OR, Vences M, Jenkins RKB, Glaw F, Kohler J (2010) Amphibians and reptiles of the Tsingy de Bemaraha Plateau, western Mada- gascar: Checklist, biogeography and conservation. Herpetological Conservation and Biology 5: 111-125.
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 30
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Brown JL, Sillero N, Glaw F, Bora P, Vieites DR, Vences M (2016) Spatial biodiversity pat- terns of Madagascar’s amphibians and reptiles. PLoS ONE 11(1): e€0144076. https:// doi.org/10.1371/journal.pone.0144076
Bruford MW, Hanotte O, Brookfield JFY, Burke T (1992) Single-locus and multilocus DNA fingerprinting. In: Hoelzel AR (Ed.) Molecular genetic analyses of populations — A practical approach. IRL Press, Oxford, 225-269.
Carné A, Vieites DR (2024) A race against extinction: The challenge to overcome the Lin- nean amphibian shortfall in tropical biodiversity hotspots. Diversity and Distributions 30(12): e13912. https://doi.org/10.1111/ddi.13912
Chapple DG, Roll U, Bohm M, Aguilar R, Amey AP Austin CC, Baling M, Barley AJ, Bates MF, Bauer AM, Blackburn DG, Bowles P Brown RM, Chandramouli SR, Chirio L, Cogger H, Colli GR, Conradie W, Couper PJ, Cowan MA, Craig MD, Das |, Datta-Roy A, Dick- man CR, Ellis RJ, Fenner AL, Ford S, Ganesh SR, Gardner MG, Geissler P, Gillespie GR, Glaw F, Greenlees MJ, Griffith OW, Grismer LL, Haines ML, Harris DJ, Hedges SB, Hitchmough RA, Hoskin CJ, Hutchinson MN, Ineich |, Janssen J, Johnston GR, Karin BR, Keogh JS, Kraus F, LeBreton M, Lymberakis P Masroor R, McDonald PJ, Mecke S, Melville J, Melzer S, Michael DR, Miralles A, Mitchell NJ, Nelson NJ, Nguyen TQ, de Campos Nogueira C, Ota H, Pafilis RP Pauwels OSG, Perera A, Pincheira-Donoso D, Reed RN, Ribeiro-Junior MA, Riley JL, Rocha S, Rutherford PL, Sadlier RA, Shacham B, Shea GM, Shine R, Slavenko A, Stow A, Sumner J, Tallowin OJS, Teale R, Torres-Car- vajal O, Trape JF, Uetz P Ukuwela KDB, Valentine L, Van Dyke JU, van Winkel D, Vas- concelos R, Vences M, Wagner P, Wapstra E, While GM, Whiting MJ, Whittington CM, Wilson S, Ziegler T, Tingley R, Meiri S (2021) Conservation status of the world’s skinks (Scincidae): Taxonomic and geographic patterns in extinction risk. Biological Conser- vation 257: 109101. https://doi.org/10.1016/j.biocon.2021.109101
Crottini A, Barbuto M, Casiraghi M, Andreone F (2011a) A rapid amphibian survey at ltremo-Ambatofinandrahana, central Madagascar, with confirmed absence of chytrid fungus and recommendations for future monitoring activities. North-Western Jour- nal of Zoology 7: 346-351.
Crottini A, Gehring PS, Glaw F, Harris DJ, Lima A, Vences M (2011b) Deciphering the cryptic species diversity of dull-coloured day geckos Phelsuma (Squamata: Gekkoni- dae) from Madagascar, with description of a new species. Zootaxa 2982(1): 40-48. https://doi.org/10.11646/zootaxa.2982.1.4
Crottini A, Miralles A, Glaw F, Harris DJ, Lima A, Vences M (2012a) Description of a new pygmy chameleon (Chamaeleonidae: Brookesia) from central Madagascar. Zootaxa 3490(1): 63-74. https://doi.org/10.11646/zootaxa.3490.1.5
Crottini A, Madsen O, Poux C, Strau& A, Vieites DR, Vences M (2012b) Vertebrate time-tree elucidates the biogeographic pattern of a major biotic change around the K-T boundary in Madagascar. Proceedings of the National Academy of Scienc- es of the United States of America 109(14): 5358-5363. https://doi.org/10.1073/ pnas.1112487109
Crottini A, Bollen A, Weldon C, Dalton DL, Kotzé A, Noél J, lambana B, Andreone F (2014) Amphibian survey and current absence of Batrachochytrium dendrobatidis (Bd) in |vo- loina Park, Toamasina (eastern Madagascar). African Journal of Herpetology 63(1): 70-78. https://doi.org/10.1080/21564574.2013.833994
Crottini A, Harris DJ, Miralles A, Glaw F, Jenkins RKB, Randrianantoandro JC, Bauer AB, Vences M (2015) Morphology and molecules reveal two new species of the poorly studied gecko genus Paragehyra (Squamata: Gekkonidae) from Madagascar. Organ- isms, Diversity & Evolution 15: 175-198. https://doi.org/10.1007/s13127-014-0191-5
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 4
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Crottini A, Gardner CJ, Pedrono M, Jenkins RKB, Behra O, Ramy A, Raxworthy CJ (2022) Conservation challenges and in situ and ex situ approaches to reptile conservation. In: Goodman SM (Ed.) The new natural history of Madagascar. Princeton Universi- ty Press, Princeton-Oxford, Volume 2, 1446-1452. https://doi.org/10.2307/j.ctv2k- s6tbb.205
D’Cruze N, Henson D, Olsson A, Emmett D (2009) The importance of herpetological sur- vey work in conserving Malagasy biodiversity. Are we doing enough? Herpetological Review 40: 19-25.
Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: More models, new heuristics and parallel computing. Nature Methods 9: 772. https://doi.org/10.1038/ nmeth.2109
Dijkstra KDB (2016) Natural history: Restore our sense of species. Nature 533: 172-174. https://doi.org/10.1038/533172a
Durkin L, Steer MD, Belle EMS (2011) Herpetological surveys of forest fragments be- tween Montagne d’‘Ambre National Park and Ankarana Special Reserve northern Madagascar. Herpetological Conservation and Biology 6: 114-126.
Gabriel DN, Gould L, Cook S (2018) Crowding as a primary source of stress in an endan- gered fragment-dwelling strepsirrhine primate. Animal Conservation 21(1): 76-85. https://doi.org/10.1111/acv.12375
Gamble T, Greenbaum E, Jackman TR, Bauer AM (2015) Into the light: Diurnality has evolved multiple times in geckos. Biological Journal of the Linnean Society. Linnean Society of London 115(4): 896-910. https://doi.org/10.1111/bij.12536
Gardner CJ, Jasper LD, Eonintsoa C, Duchene JJ, Davies ZG (2016) The impact of nat- ural resource use on bird and reptile communities within multiple-use protected ar- eas: Evidence from sub-arid Southern Madagascar. Biodiversity and Conservation 25: 1773-1793. https://doi.org/10.1007/s10531-01 6-1160-4
Gardner CJ, Cripps G, Day LP Dewar K, Gough C, Peabody S, Tahindraza G, Harris A (2020) A decade and a half of learning from Madagascar’s first locally managed marine area. Conservation Science and Practice 2(12): e298. https://doi.org/10.1111/csp2.298
Gehring PS, Ratsoavina FM (2022) Gekkonidae: Phelsuma, day geckos, katsatsaka, tsatsake. In: Goodman SM (Ed.) The new natural history of Madagascar. Princeton University Press, Princeton-Oxford, Volume 2, 1485-1490. https://doi.org/10.2307/j. ctv2ks6tbb.213
Gehring PS, Pabijan M, Ratsoavina FM, Kohler J, Vences M, Glaw F (2010) A Tarzan yell for conservation: A new chameleon, Calumma tarzan sp. n., proposed as a flagship species for the creation of new nature reserves in Madagascar. Salamandra (Frank- furt) 46: 167-179.
Gehring PS, Ratsoavina FM, Raselimanana AP, Raxworthy CJ, Scherz MD (2022) Gek- konidae: Uroplatus, leaf-tailed geckos, tahafisaka. In: Goodman SM (Ed.) The new natural history of Madagascar. Princeton University Press, Princeton-Oxford, Volume 2, 1480-1485. https://doi.org/10.2307/j.ctv2ks6tbb.212
Giam X, Scheffers BR, Sodhi NS, Wilcove DS, Ceballos G, Ehrlich PR (2012) Reservoirs of richness: Least disturbed tropical forests are centres of undescribed species diversi- ty. Proceedings of the Royal Society B Biological Sciences 279(1726): 67-76. https:// doi.org/10.1098/rspb.2011.0433
Glaw F, Schmidt K (2003) Beobachtungen an Paragehyra petiti, einem lange zeit ver- schollenen gecko aus Madagaskar (Sauria: Gekkonidae). Gekkota 4: 34-39.
Glaw F, Vences M (2007) A Field Guide to the Amphibians and Reptiles of Madagascar. 3 edn. Vences & Glaw Verlag, Cologne, 495 pp.
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 32
Francesco Belluardo et al.: Anew gecko species of the genus Paragehyra
Glaw F, Vences M, Raxworthy CJ (2022) Diversity and exploration of the Malagasy rep- tile fauna. In: Goodman SM (Ed.) The new natural history of Madagascar. Princeton University Press, Princeton-Oxford, Volume 2, 1423-1442. https://doi.org/10.2307/j. ctv2ks6tbb.203
Goodman SM (1996) A Floral and Faunal Inventory of the Eastern Slopes of the Reserve Naturelle Integrate d’Andringitra, Madagascar, with Reference to Elevational Varia- tion. Fieldiana, Zoology, New Series, Field Museum of Natural History, Chicago, 319 pp. https://doi.org/10.5962/bhI.title.3458
Goodman SM, Raherilalao MJ, Wohlhauser S (2018) Les Aires Protégées Terrestres de Madagascar: Leur Historie, Description et Biote / The Terrestrial Protected Areas of Madagascar: Their History, Description, and Biota. Association Vahatra, Antananari- vo, 1/16 pp.
Gould L, Andrianomena P (2015) Ring-tailed lemurs (Lemur catta), forest fragments, and community-level conservation in south-central Madagascar. Primate Conservation 2015(29): 67-73. https://doi.org/10.1896/052.029.0108
Gould L, Gabriel DN (2015) Wet and dry season diets of the Endangered Lemur catta (ring- tailed lemur) in two mountainous rocky outcrop forest fragments in south-central Mad- agascar. African Journal of Ecology 53(3): 320-330. https://doi.org/10.1111/aje.12186
Grandidier A (1867) Liste des reptiles nouveaux découverts, en 1866, sur la cOte sud- ouest de Madagascar. Revue et Magazine de Zoologie Série 19(2): 232-234.
Gray JE (1842) Description of some new species of reptiles, chiefly from the British Museum collection. Zoological Miscellany 2: 57-59.
Hall TA (1999) BioEdit: A user-friendly biological sequence alignment editor and anal- ysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98. Irwin MT, Wright PC, Birkinshaw C, Fisher BL, Gardner CJ, Glos J, Goodman SM, Loiselle
P Rabeson P Raharison JL, Raherilalao MJ, Rakotondravony D, Raselimanana A, Rat- simbazafy J, Sparks JS, Wilmé L, Ganzhorn JU (2010) Patterns of species change in anthropogenically disturbed forests of Madagascar. Biological Conservation
143(10): 2351-2362. https://doi.org/10.1016/j.biocon.2010.01.023
IUCN Standards and Petitions Committee (2024) The IUCN Red List of Threatened Spe- cies™ Guidelines for Using the IUCN Red List Categories and Criteria, version 16. https://www.iucnredlist.org/documents/RedListGuidelines. pdf
Jenkins RK, Tognelli MF, Bowles P, Cox N, Brown JL, Chan L, Andreone F, Andriamazava A, Andriantsimanarilafy RR, Anjeriniaina M, Bora P Brady LD, Hantalalaina EF, Glaw F, Griffiths RA, Hilton-Taylor C, Hoffmann M, Katariya V, Rabibisoa NH, Rafanomezant- soa J, Rakotomalala D, Rakotondravony H, Rakotondrazafy N, Ralambonirainy J, Ra- manamanjato JB, Randriamahazo H, Randrianantoandro JC, Randrianasolo HH, Ran- drianirina JE, Randrianizahana H, Raselimanana AP, Rasolohery A, Ratsoavina FM, Raxworthy CJ, Robsomanitrandrasana E, Rollande F, van Dijk PP Yoder AD, Vences M (2014) Extinction risks and the conservation of Madagascar’s reptiles. PLoS ONE 9(8): e100173. https://doi.org/10.1371/journal.pone.0100173
Kumar S, Stecher G, LiM, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary ge- netics analysis across computing platforms. Molecular Biology and Evolution 35(6): 1547-1549. https://doi.org/10.1093/molbev/msy096
Lehtinen RM, Ramanamanjato JB (2006) Effects of rainforest fragmentation and cor- relates of local extinction in a herpetofauna from Madagascar. Applied Herpetology 3: 95-110. https://doi.org/10.1163/157075406776984248
Long S, Thurlow G, Jones PJS, Turner A, Randrianantenaina SM, Gammage T, Savage J, Ndriamanja JR (2021) Critical analysis of the governance of the Sainte Luce Locally
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 44
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Managed Marine Area (LMMA), southeast Madagascar. Marine Policy 127: 103691. https://doi.org/10.1016/j.marpol.2019.103691
Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. 2010 Gateway Computing Environments Workshop, GCE 2010, New Orleans, LA, USA, 2010, 1-8. https://doi.org/10.1109/ GCE.2010.5676129
Miralles A, Bruy T, Crottini A, Rakotoarison A, Ratsoavina FM, Scherz MD, Schmidt R, Kohler J, Glaw F, Vences M (2021) Completing a taxonomic puzzle: Integrative review of geckos of the Paroedura bastardi species complex (Squamata, Gekkonidae). Ver- tebrate Zoology 71: 27-48. https://doi.org/10.3897/vz.71.e59495
Miralles A, Puillandre N, Vences M (2024) DNA barcoding in species delimitation: From genetic distances to integrative taxonomy. In: DeSalle R (Ed.) DNA barcoding, meth- ods in molecular biology. Humana, New York, Volume 2744, 77-104. https://doi. org/10.1007/978-1-0716-3581-0_4
Moura MR, Jetz W (2021) Shortfalls and opportunities in terrestrial vertebrate species discovery. Nature Ecology & Evolution 5: 631-639. https://doi.org/10.1038/s41559- 021-01411-5
Mufoz-Pajares AJ, Belluardo F, Cocca W, Crottini A (2020) PipeLogeny: An automated pipeline for phylogenetic reconstruction https://sites.google.com/site/pipelogeny- download/ [Accessed 01.04.2023]
Nagy ZT, Sonet G, Glaw F, Vences M (2012) First large-scale DNA barcoding assessment of reptiles in the biodiversity hotspot of Madagascar, based on newly designed COl primers. PLoS ONE 7(3): e34506. https://doi.org/10.1371/journal.pone.0034506
Nopper J, Ranaivojaona A, Riemann JC, Rédel MO, Ganzhorn JU (2017) One forest is not like another: The contribution of community-based natural resource management to reptile conservation in Madagascar. Tropical Conservation Science 10: 1-9. https:// doi.org/10.1177/194008291 7693234
Nopper J, Riemann JC, Brinkmann K, R6del MO, Ganzhorn JU (2018) Differences in land cover-biodiversity relationships complicate the assignment of conservation values in human-used landscapes. Ecological Indicators 90: 112-119. https://doi. org/10.1016/j.ecolind.2018.02.004
Nussbaum RA, Raxworthy CJ (1994) The genus Paragehyra (Reptilia: Sauria: Gek- konidae) in southern Madagascar. Journal of Zoology 232(1): 37-59. https://doi. org/10.1111/j.1469-7998.1994.tb01558.x
Oppel M (1811) Die Ordnungen, Familien und Gattungen der Reptilien als Prodrom einer Naturgeschichte derselben. J. Lindauer, Munchen, 86 pp. https://doi.org/10.5962/ bhI.title.4911
Padial JM, Miralles A, De la Riva |, Vences M (2010) The integrative future of taxonomy. Frontiers in Zoology 7: 16. https://doi.org/10.1186/1742-9994-7-16
Palumbi S, Martin A, Romano S, McMillan WO, Stice L, Grabowski G (1991) The Simple Fool’s Guide to PCR. Department of Zoology, Honolulu, 45 pp.
Piccoli C, Belluardo F, Lobon-Rovira J, Oliveira Alves |, Rasoazanany M, Andreone F, Rosa GM, Crottini A (2023) Another step through the crux: A new microendemic rock-dwell- ing Paroedura (Squamata, Gekkonidae) from south-central Madagascar. ZooKeys 1181: 125-154. https://doi.org/10.3897/zookeys.1181.108134
Primack RB (2014) Essential of Conservation Biology. 6 edn. Sinauer Associates, Sun- derland, 603 pp.
Protzel D, Vences M, Hawlitschek O, Scherz MD, Ratsoavina FM, Glaw F (2018) Endan- gered beauties: micro-CT cranial osteology, molecular genetics and external mor-
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 34
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
phology reveal three new species of chameleons in the Calumma boettgeri complex (Squamata: Chamaeleonidae). Zoological Journal of the Linnean Society 184(2): 471-498. https://doi.org/10.1093/zoolinnean/zlx112
R Core Team (2022) R: A language and environment for statistical computing. R Founda- tion for Statistical Computing, Vienna. https://www.R-project.org/
Raik D (2007) Forest management in Madagascar: An historical overview. Madagascar Conservation and Development 2(1): 5-10. https://doi.org/10.4314/mced.v2i1.44123
Rakotoarison A, Scherz MD, Glaw F, Kohler J, Andreone F, Franzen M, Glos J, Hawlitschek O, Jono T, Mori A, Ndriantsoa SH, Raminosoa NR, Riemann JC, Rodel MO, Rosa GM, Vieites DR, Crottini A, Vences M (2017) Describing the smaller majority: Integrative taxonomy reveals twenty-six new species of tiny microhylid frogs (genus Stumpffia) from Madagascar. Vertebrate Zoology 67(3): 271-398. https://doi.org/10.3897/ vz.67.€31595
Ralimanana H, Perrigo AL, Smith RJ, Borrell JS, Faurby S, Rajaonah MT, Randriamboavon- jy T, Vorontsova MS, Cooke RSC, Phelps LN, Sayol F, Andela N, Andermann T, Andria- manohera AM, Andriambololonera S, Bachman SP, Bacon CD, Baker WJ, Belluardo F, Birkinshaw C, Cable S, Canales NA, Carrillo JD, Clegg R, Clubbe C, Crottini A, Damas- co G, Dhanda S, Edler D, Farooq H, de Lima Ferreira P Fisher BL, Forest F, Gardiner LM, Goodman SM, Grace OM, Guedes TB, Hackel J, Henniges MC, Hill R, Lehmann CER, Lowry PP, Marline L, Matos-Maravi P, Moat J, Neves B, Nogueira MGC, Onstein RE, Papadopulos AST, Perez-Escobar OA, Phillipson PB, Pironon S, Przelomska NAS, Rabarimanarivo M, Rabehevitra D, Raharimampionona J, Rajaonary F, Rajaovelona LR, Rakotoarinivo M, Rakotoarisoa AA, Rakotoarisoa SE, Rakotomalala HN, Rakotona- solo F, Ralaiveloarisoa BA, Ramirez-Herranz M, Randriamamonjy JEN, Randrianasolo V, Rasolohery A, Ratsifandrihamanana AN, Ravololomanana N, Razafiniary V, Razana- jatovo H, Razanatsoa E, Rivers M, Silvestro D, Testo W, Torres Jiménez MF, Walker K, Walker BE, Wilkin P Williams J, Ziegler T, Zizka A, Antonelli A (2022) Madagascar’s extraordinary biodiversity: Threats and opportunities. Science 378(6623): eadf1466. https://doi.org/10.1126/science.adf1466
Rambaut A (2009) FigTree 1.3.1 http://tree.bio.ed.ac.uk/software/figtree/ [Accessed 10.05.2018].
Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA (2018) Posterior summariza- tion in bayesian phylogenetics using Tracer 1.7. Systematic Biology 67(5): 901-904. https://doi.org/10.1093/sysbio/syy032
Raselimanana AP, Vences M (2022) Reptiles introduced to and from Madagascar. In: Goodman SM (Ed.) The new natural history of Madagascar. Princeton University Press, Princeton-Oxford, Volume 2, 1455-1458. https://doi.org/10.2307/j.ctv2k- s6tbb.207
Rasolofoson RA, Ferraro PJ, Jenkins CN, Jones JP (2015) Effectiveness of community forest management at reducing deforestation in Madagascar. Biological Conserva- tion 184: 271-277. https://doi.org/10.1016/j.biocon.2015.01.027
Roll U, Feldman A, Novosolov M, Allison A, Bauer AM, Bernard R, Bohm M, Castro-Her- rera F, Chirio L, Collen B, Colli GR, Dabool L, Das |, Doan TM, Grismer LL, Hoogmoed M, ltescu Y, Kraus F, LeBreton M, Lewin A, Martins M, Maza E, Meirte D, Nagy ZT, de C Nogueira C, Pauwels OSG, Pincheira-Donoso D, Powney GD, Sindaco R, Tallowin OJS, Torres-Carvajal O, Trape J-F, Vidan E, Uetz P Wagner P Wang Y, Orme CDL, Grenyer R, Meiri S (2017) The global distribution of tetrapods reveals a need for targeted reptile conservation. Nature Ecology & Evolution 1: 1677-1682. https://doi.org/10.1038/ $41559-017-0332-2
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 35
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Ronquist F, Teslenko M, van Der Mark P Ayres DL, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539-542. https://doi.org/10.1093/sysbio/sys029
Rozas J, Ferrer-Mata A, Sanchez-DelBarrio JC, Guirao-Rico S, Librado P Ramos-On- sins SE, Sanchez-Gracia A (2017) DnaSP 6: DNA sequence polymorphism analysis of large data sets. Molecular Biology and Evolution 34(12): 3299-3302. https://doi. org/10.1093/molbev/msx248
Salzburger W, Ewing GB, Von Haeseler A (2011) The performance of phylogenetic algo- rithms in estimating haplotype genealogies with migration. Molecular Ecology 20(9): 1952-1963. https://doi.org/10.1111/j.1365-294X.2011.05066.x
Stephens M, Donnelly P (2003) A comparison of bayesian methods for haplotype re- construction from population genotype data. American Journal of Human Genetics 73(5): 1162-1169. https://doi.org/10.1086/379378
Stephens M, Smith NJ, Donnelly P (2001) A new statistical method for haplotype recon- struction from population data. American Journal of Human Genetics 68(4): 978- 989. https://doi.org/10.1086/319501
Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-spe- cific gap penalties and weight matrix choice. Nucleic Acids Research 22(22): 4673- 4680. https://doi.org/10.1093/nar/22.22.4673
Uetz P, Freed P, HoSek J (2025) The Reptile Database. http://www.reptile-database.org [accessed on 02 Feb 2025]
Vences M, Wollenberg KC, Vieites DR, Lees DC (2009) Madagascar as a model region of species diversification. Trends in Ecology & Evolution 24(8): 456-465. https://doi. org/10.1016/j.tree.2009.03.011
Vences M, Brown JL, Crottini A, D’'Cruze N, Gardner CJ, Miralles A, Raselimanana AP Rax- worthy CJ (2022a) Species inventories, biogeography, phylogeography, and species formation of reptiles on Madagascar. In: Goodman SM (Ed.) The new natural history of Madagascar. Princeton University Press, Princeton-Oxford, Volume 2, 1442-1445. https://doi.org/10.2307/j.ctv2ks6tbb.204
Vences M, Multzsch M, Gippner S, Miralles A, Crottini A, Gehring PS, Rakotoarison A, Ratsoavina FM, Glaw F, Scherz MD (2022b) Integrative revision of the Lygodactylus madagascariensis group reveals an unexpected diversity of little brown geckos in Madagascar’s rainforest. Zootaxa 5179(1): 1-61. https://doi.org/10.11646/zoot- axa.5179.1.1
Vieilledent G, Grinand C, Rakotomalala FA, Ranaivosoa R, Rakotoarijaona JR, Allnutt TF, Achard F (2018) Combining global tree cover loss data with historical national for- est cover maps to look at six decades of deforestation and forest fragmentation in Madagascar Biological Conservation 222: 189-197. https://doi.org/10.1016/j.bio- con.2018.04.008
Vieites DR, Min MS, Wake DB (2007) Rapid diversification and dispersal during periods of global warming by plethodontid salamanders. Proceedings of the National Acad- emy of Sciences of the United States of America 104(50): 19903-19907. https://doi. org/10.1073/pnas.0705056104
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 36
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Vieites DR, Wollenberg KC, Andreone F, Kohler J, Glaw F, Vences M (2009) Vast under- estimation of Madagascar’s biodiversity evidenced by an integrative amphibian in- ventory. Proceedings of the National Academy of Sciences of the United States of America 106(20): 8267-8272. https://doi.org/10.1073/pnas.0810821106
Wright SJ (2010) The future of tropical forests. Annals of the New York Academy of Sciences 1195(1): 1-27. https://doi.org/10.1111/j.1749-6632.2010.05455.x
Yoder AD, Heckman KL (2006) Mouse lemur phylogeography revises a model of eco- geographic constraint in Madagascar. In: Lehman SM, Fleagle J (Eds) Primate bio- geography, developments in primatology: Progress and prospects. Springer, Boston, 255-268. https://doi.org/10.1007/0-387-31 710-4_9
Yoder AD, Olson LE, Hanley C, Heckman KL, Rasoloarison R, Russell AL, Ranivo J, Soar- imalala V, Karanth KP Raselimanana AP Goodman SM (2005) A multidimensional approach for detecting species patterns in Malagasy vertebrates. Proceedings of the National Academy of Sciences of the United States of America 102(suppl. 1): 6587-6594. https://doi.org/10.1073/pnas.0502092102
Zheng Y, Wiens JJ (2016) Combining phylogenomic and supermatrix approaches, and a time-calibrated phylogeny for squamate reptiles (lizards and snakes) based on 52 genes and 4162 species. Molecular Phylogenetics and Evolution 94(Part B): 537- 547. https://doi.org/10.1016/j.ympev.2015.10.009
Supplementary material 1
Samples analysed in this study
Authors: Francesco Belluardo, Costanza Piccoli, Javier Lobon-Rovira, Ivo Oliveira Alves, Malalatiana Rasoazanany, Franco Andreone, Goncalo M. Rosa, Angelica Crottini
Data type: xls
Explanation note: Samples analysed in this study with information on sampling local- ities, coordinates, elevation, extraction code, field number, institutional catalogue number (for voucher specimens), status, and GenBank accession numbers for frag- ments of the cytochrome oxidase | gene (COl), the 3’ terminus of the 16S rRNA gene (16S), pro-opiomelanocortin gene (POMC), brain-derived neurotrophic factor gene (BDNF) and recombination activating gene 1 (Rag1). Samples of Paragehyra tsara- noro sp. nov. and the individuals of P. felicitae analysed in this study for the first time are marked with an asterisk (*), while the reaming data are from Crottini et al. (2015). Rag1 accession numbers are reported (from Crottini et al. 2015), although this mark- er has not been included in our analyses. Accession numbers of newly generated sequences are in bold.
Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Link: https://doi.org/10.3897/zookeys.1240.151016.suppl1
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 37
Francesco Belluardo et al.: A new gecko species of the genus Paragehyra
Supplementary material 2
Measurements and variation of non-diagnostic morphological characters of Paragehyra specimens
Authors: Francesco Belluardo, Costanza Piccoli, Javier Lobon-Rovira, Ivo Oliveira Alves, Malalatiana Rasoazanany, Franco Andreone, Gongalo M. Rosa, Angelica Crottini
Data type: xls
Explanation note: Measurements and variation of non-diagnostic morphological char- acters of Paragehyra specimens. Specimens of Paragehyra tsaranoro sp. nov. and the new individuals of P. felicitae analysed in this study are highlighted in bold, while the remaining specimens are from Crottini et al. (2015) (with the relative information on measurements and states/numbers). Refer to the Materials and methods section of the manuscript for the definitions of characters. Measurements are expressed in mm except for SLMP, 2PM, SCE, IN, SL, and PCP where symbols/numbers indicate the state or number of observed lamellae/scales/pores. Tail length (TAL) is provided in parenthesis if regenerated. The number of subdigital lamellae (SLMP) is provided for the left side of manus and pes (-, lamellae absent). SCE (+, present; -, absent). IN (#, number of internasal scales; +, presence of concave groove between nasals; -, absence of concave groove between nasals; c, nasals in contact; nc, nasals not in contact). The number of enlarged supralabial scales (SL) and precloacal pores (PCP) are provided for the right and left sides. NA, not available.
Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Link: https://doi.org/10.3897/zookeys.1240.151016.suppl2
ZooKeys 1240: 1-38 (2025), DOI: 10.3897/zookeys.1240.151016 38